Сип технология строительства: Что такое SIP технология? | homify

Содержание

Технология строительства дома

Строительство дома по технологии SIP (СИП) состоит из тех же этапов, что и строительство по практически любой другой технологии:

  • устройство фундамента;
  • возведение «коробки»;
  • устройство крыши и покрытие ее кровельным материалом;
  • установка окон и входных дверей;
  • отделка фасада и цоколя;
  • подшивка свесов и устройство водосливной системы;
  • прокладка внутренних коммуникаций;
  • черновая и чистовая внутренняя отделка. 

 

Надежный фундамент – основа прочного дома. Глубина заложения и тип фундамента зависят от несущей способности грунтов, рельефа местности, уровня грунтовых вод и, конечно, предполагаемой нагрузки на него.

Принято считать, что стоимость возведения фундамента составляет примерно 20% от стоимости дома. Однако при создании проектов и строительстве легких каркасных домов из SIP-панелей целесообразно использовать либо мелкозаглубленные фундаменты, либо буроналивные (набивные) сваи с подвесным ростверком (бетонным или брусовым).

Данные типы фундамента наряду с надежностью позволяют значительно сократить расход материалов и снизить трудозатраты. 

 

В последнее время получают популярность ещё более экономичные фундаменты – металлические винтовые сваи. Сваи при этом могут быть как оцинкованными, так и просто с антикоррозийным покрытием; с литым наконечником или наварными лопастями; могут соединяться между собой («обвязываться») как швеллером, так и просто брусом по так называемым «оголовкам». Главное достоинство винтовых свай (помимо стоимости работ и материалов) — это возможность устройства фундамента в сжатые сроки и при любой погоде. Свайное поле под двухэтажный дом площадью 200м² готовится в течении 2-3 дней даже по промёрзшей земле.

Для каждого конкретного случая мы рассчитываем необходимый фундамент, руководствуясь нормами ТСН МФ-97-МО (Проектирование, расчет и устройство малозаглубленных фундаментов жилых малоэтажных зданий в Московской области) или нормами для других регионов.  В случае необходимости до начала монтажных работ проводится прокладка инженерных коммуникаций, оставляются «закладные» под ввод в дом воды и вывода канализации.

 

Как правило, параллельно процессу строительства фундамента на нашем заводе в городе Волоколамске производится комплект будущего дома. Наклеенные ранее SIP панели и калиброванный пиломатериал камерной сушки раскраиваются/распиливаются и маркируются в конечные изделия согласно проекта. По факту готовности стройплощадки к началу сборки на объект завозится домокоплект. SIP-панели имеют малую массу, что дает возможность двум рабочим без особых усилий их переносить и монтировать. 

 

Монтаж дома начинается с крепления на готовый фундамент бруса, обработанного антисептиком, являющегося обвязочным контуром для монтажа панелей. Крепление бруса к фундаменту осуществляется анкерными болтами через гидроизолирующий материал. Плиты перекрытия укладываются на обвязочный брус цоколя, образуя ровный прочный щит. Несущим элементом перекрытия цоколя является деревянный брус сечением 190х80мм, идущий с шагом 625мм, на который как бы нанизываются панели перекрытия. Во избежание образования «мостиков холода» в местах соединения все незначительные пустоты заполняются монтажным пенополиуретановым герметиком. После завершения сборки перекрытия его торец по периметру дома зашивается доской 190х40мм. Для улучшения гидроизолирующего свойства, плиты перекрытия могут покрываются снизу слоем битумной мастики. Однако, более практичным является устройство вентилируемого подпола.

 

Далее наступает самый ответственный момент: строго согласно чертежей дома делается раскладка нижнего обвязочного бруса стен первого этажа. Брус кладётся на пенополиуретановый герметик и закрепляется длинными саморезами сквозь панели перекрытия к обвязочному брусу цоколя.

Монтаж стеновых SIP-панелей начинают с угла сборного дома. Нижний паз первой стеновой панели надевается на обвязочный брус и выставляется по уровню с максимально допустимым отклонением не более 1-1,5 мм. Торец панели закрывают закладной доской. Перед стыковкой всех перечисленных элементов все контакты пропениваются.

Вторую угловую панель, торец которой также закрыт доской, соединяют под прямым углом с первой панелью. Для соединения используют анодированные саморезы длиной 200мм. Стык герметизируют пенополиуретановым герметиком. Точные линейные размеры стеновой SIP-панели позволяют вести сборку дома с допуском не более 1-2 мм.

   

Стеновые SIP-панели с оконными и дверными проемами монтируются и крепятся к обвязочному брусу и между собой так же, как и сплошные стеновые панели. По периметру проёмов вставляется закладной брус.

Внутренние несущие и ненесущие перегородки в доме могут быть выполнены как стеновыми SIP-панелями толщиной 164 и 124мм, так и стандартными деревянно-каркасными конструкциями с заполнением пустот звукоизолирующим материалом. Ненесущие перегородки могут монтироваться и с использованием металлопрофиля.

Правильность монтажа по вертикали проверяется измерительным уровнем. В случае необходимости производится монтаж опорного клеёного или ЛВЛ бруса.

После установки стены первого этажа закрепляются верхним обвязочным брусом.

Межэтажные перекрытия могут выполняться из усиленных SIP-панелей (шаг между балками 625мм), стандартной балочной конструкцией, а в случае больших пролётов с использованием деревянных двутавровых балок на которые монтируют настил из OSB. Преимуществом последних двух вариантов является возможность проведения инженерных коммуникаций внутри перекрытия.

После этого, согласно проекта, делается раскладка нижнего обвязочного бруса второго (или мансардного) этажа. Брус кладётся на пенополиуретановый герметик и закрепляется длинными саморезами, сквозь панели перекрытия, к верхнему обвязочному брусу первого этажа. Монтаж стеновых панелей осуществляется также как на первом этаже.

Нестандартные узлы, например фронтоны, могут изготавливаться в заводских условиях, с заранее выполненными проемами дверей и окон.

По завершению монтажа стен мансардного этажа устанавливаются мауэрлаты, прогоны и коньки. Причём, очень важно, чтобы не только поверхность их соприкосновения с кровельными панелями была идеальной, но и сделаны они были из качественного сухого бруса. В противном случае, в процессе эксплуатации дома, при высыхании конструкций, произойдёт деформация и образуется щель. В конструкции кровли используются усиленные SIP-панели.

Сборка конструкции холодной кровли выполняется традиционными методами.

   

Основными используемыми кровельными материалами являются мягкая черепица и металлочерепица. Мы не рекомендуем напрямую монтировать на кровельные SIP-панели мягкую черепицу без устройства вентиляционного продуха, поскольку это сократит срок жизни кровельных конструкций. В целях снижения себестоимости возможно использование Ондулина и оцинкованного гофролиста.

Параллельно с кровельными работами монтируются капельники и ветровые, затем устанавливаются окна.

Следующие этапы работ выполняются параллельно, независимо друг от друга.

По желанию заказчика возможна любая отделка фасада дома: декоративная штукатурка, расшивка фахверком, имитацией бруса, шилдингом, виниловым сайдингом или клинкерными термопанелями.

   

Одновременно с отделкой фасада дома можно приступать к разводке инженерных коммуникаций. Конструкция дома позволяет реализовать любые инженерно-технические решения, как традиционные, так и самые инновационные. К традиционным инженерным системам мы относим системы, в которых контуры отопления работают на принципах циркуляции различных типов носителей с использованием таких отопительных элементов как радиаторы, конвектора и тёплый пол. Трассы труб и кабель каналов внутри дома могут проходить в межкомнатных перегородках, в наборных перекрытиях и по перекрытиям из СИП-панелей с прокладкой в традиционной стяжке, или в сухой стяжке по методике KNAUF. Возможна и наружная прокладка коммуникаций всех видов.

В помещениях санузлов перед началом заливки стяжки и прокладки коммуникаций делается гидроизоляция, затем монтируются трубы канализации и водопровода, и после этого заливается такая же, как и везде, стяжка, но с добавлением в раствор состава, не пропускающего влагу.

Конструкция стен позволяет реализовать любые традиционные и современные технологии отделки. Мы рекомендуем все стены, внутри дома, зашить гипсокартонном, что не только повысит степень огнестойкости конструкции и улучшит звукоизоляцию, но и упростит чистовую внутреннюю отделку.

Технология строительства из СИП панелей — I-SIP

29.12.2018

926

Время чтения: 5 минут

Построить тёплый, уютный, красивый дом — это не такая уж простая задача. Трудности возникают уже на этапе проектирования: многие не могут определиться с материалом, из которого будет возведено жилище. Отличный вариант — СИП панели. Благодаря своим замечательным эксплуатационным характеристикам они становятся всё более популярными в нашей стране.

Сами СИП панели разделяются на множество подвидов, но конструктивно это всегда один и тот же «бутерброд». Утеплительный материал (чаще всего — пенополистирол) зажимается между двумя плитами, сделанными из сочетания бетона и древесной стружки в разных пропорциях или иных материалов. Внешне это выглядит как сэндвич, отсюда второй название — «сэндвич панели». Финальная стадия изготовления — плита утеплителя, зажатая между двумя другими плитами отправляется под пресс, чтобы стать единым целым. 

Такой метод изготовления наделяет СИП панели свойствами, очень полезными в домостроительстве — они показывают отличную теплоизоляцию и звукоизоляцию. Помимо этого, панели легки и прочны, что позволяет легко монтировать их практически на любых участках строящегося дома. Так как в составе СИП панели есть теплоизоляционный материал, не нужно тратить деньги на минеральную вату или иные утеплители. Тем не менее, если использовать этот стройматериал неправильным образом, его плюсы «обнулятся». 

Современные строительные решения: технология I-SIP

Компания «ИнтерСити» изобрела уникальную методику строительства жилых домов, которая называется I-SIP. В её основе лежит два принципа — энергоэффективность и экономия. Суть заключается в том, что при строительстве комбинируется два отличных строительных материала, которые раньше почему-то всегда использовались по отдельности. Речь идёт о двутавровых балках и СИП панелях. Их сочетание творит чудеса. Дома, построенные по технологии I-SIP, получаются необычайно тёплыми и удобными, причём всё это — за весьма скромные деньги!

Заменив обычный деревянный брус двутавровой балкой, мы достигли очень интересных результатов. Заключаются они в том, что:

  • Так называемый «мостик холода» был значительно уменьшен;
  • Брус часто подвергается гниению и прению при монтаже СИП панелей. С двутавровыми балками эта проблема исключена, так как их полки находятся вне самих панелей;
  • Используемые нами двутавровые балки идеально выточены и хорошо просушены, а потому их легко монтировать с СИП панелями;
  • Полки двутавровых балок могут выполнять функцию обрешётки при внутренней и внешней отделке;
  • Прокладывать коммуникации при использовании двутавров легко.

Помимо этого и у двутавров, и у СИП панелей есть ещё несколько преимуществ, связанных с транспортировкой и монтажом. Для строительства описываемой методикой СИП панели делаются без пазов, а потому они не повреждаются при транспортировке, что весьма удобно.

Ещё несколько преимуществ I-SIP

Конструирование зданий по технологии I-SIP позволяет снизить нагрузку на сам стройматериал — двутавровые балки, являясь опорами, берут всю нагрузку на себя. Также конструкция получается гораздо более жёсткой благодаря уменьшенному шагу стоек. Мы используем тонкие СИП панели (9 мм OSB вместо 12). Это возможно благодаря энергоэффективности всей конструкции и позволяет сэкономить на строительстве. 

Очень важной особенностью данного метода постройки является то, что строить можно в любое время года, в том числе — осенью и зимой. При возведении домов по технологии I-SIP не используются жидкие и полужидкие строительные смеси, что также весьма упрощает монтаж.


Упростить Вам задачу?

Мы хотим не просто рассказать подробнее о технологии строительства домов из СИП панелей, но и наглядно продемонстрировать практичность и надежность данной конструкции. Пришлите нам чертежи вашего будущего дома и мы подготовим проект дома, сделаем спецификацию и посчитаем коммерческое предложение. И, конечно, пригласим обсудить Ваш проект в мельчайших деталях.

Денис Красуленков, Инженер-проектировщик

Позвоните нам

*бесплатная раскладка за 24 часа


СИП-технология

Отдельно от себя хотелось бы сказать следующее — когда возник вопрос постройки дома для себя, я изучил массу вариантов технологий строительства. Традиционные были отметены сразу по следующим причинам: сроки строительства плюс человеческий фактор при производстве работ превращали конечный результат в казино. Т.е. совершенно непредсказуемая стоимость строительства и сколько времени это продолжится относилось к области личного везения. Очень много времени ушло на изучение каркасных технологий. Цена и кажущаяся легкость монтажа очень привлекала.

Но ураганы в США очень заставили задуматься о надежности, а более углубленное изучение процесса производства и последующей эксплуатации этих домов заставили вернуться к уже известному мне тогда SIP домостроению.

Решение было принято, первый комплект произвели и смонтировали на фундамент. Очень беспокоили такие вопросы: как поведет себя каркас внутри коробки дома, нагрузки на перекрытия, теплый ли дом, усадка, как выдерживает ветровые и снеговые нагрузки т.д.

В течении двух лет дом подвергался всем климатическим воздействиям. Незащищенный фасад, два месяца под проливными дождями без кровельного покрытия, ураганные ветра Калининградской области не повредили, не дали гниения конструкции, не изменили геометрию коробки дома.

Теперь я с большой уверенность могу сказать, основываясь на личной практике, технология строительства из структурно-изоляционных панелей отличное решения для строительства своего дома. В ходе строительства этого и последующих домов были выявлены действительно низкие показатели человеческого фактора, что позволят смело декларировать сроки и стоимость конечного строительства. Ну а про «теплые ли дома» можно поговорить с нашими отделочниками. Они первые оценили как приятно вести отделочные работы в сухих и теплых помещениях только возведенного дома.

С уважением, директор ООО «СИП Хаус» Иванов Алексей.

Преимущества  СИП-технологии

  • внутренние коммуникации (водопровод, канализация, разводка системы отопления) спрятаны в стены;
  • возможность использования всего спектра наружных и внутренних отделочных материалов;
  • возможность применения разнообразных архитектурных форм;
  • высокие энергосберегающие и экологические свойства  жилья;
  • здание долговечно, кроме того его легко реконструировать;
  • идеальные поверхности пола, стен и потолков для высококлассной отделки помещений;
  • лучшее соотношение цена/качество;
  • отсутствие «мостиков холода» в конструкции здания;
  • повышенная устойчивость здания к просадкам;
  • тяжелые подъемные механизмы в строительстве не используются;
  • устойчивость готового здания к атмосферным влияниям;
  • эффективность использования застраиваемой площади.

Технология строительства из СИП-панелей

Фундамент

Строительные нормы рекомендуют закладывать фундаменты на глубину промерзания грунта. Сооружение фундамента на такой глубине сопряжено с большим объемом земляных работ, и соответственно, со значительными расходами. За счет легкости конструкций из SIP панелей значительно уменьшается нагрузка на фундамент и появляется возможность удешевить его. При проектировании и строительстве зданий из СИП-панелей наиболее целесообразно использовать ленточный малозаглубленный фундамент или столбчатый, который позволяет значительно сократить расход материалов и снизить трудозатраты. Такой фундамент является надежным и экономически оправданным.

Темпы строительства

Как минимум в 20 раз быстрее традиционных методов (по существующим нормам для возведения 1м2 кирпичной стены толщиной 62 см каменщику требуется 4,33 часа, т.е. 260 минут, а для возведения 1м2 стены из СИП-панели рабочему требуется 2 минуты!).

Затраты на отопление

В 5 — 6 раз меньше, чем на отопление стандартного кирпичного дома (коэффициент сопротивления теплопередаче пенополистирола составляет 0,041 Вт/мК, что в 20 раз меньше подобного показателя кирпичной стены). Практика показала, что в период постоянного роста цен на отопление, подобное здание полностью себя окупает в течение 10 лет только по экономии средств на обогрев. При этом владельцу здания нет необходимости приобретать мощную и, соответственно, дорогостоящую отопительную установку.

Экологическая чистота

В развитых странах мира из пенополистирола строят больницы, дома для престарелых, а ведь к этим зданиям предъявляются требования выше обычных. Даже люди с аллергией и астмой специально строят себе дома из этого материала.

Долговечность

Благодаря уникальным свойствам ОСП–3 (применяется синтетический воск, добавляются соли борной кислоты) увеличиваются защитные свойства плиты. Панели не подвержены впитыванию влаги, гниению, а так же обладают высокой устойчивостью к перепадам температуры от – 50 до + 50°С. В Финляндии, Канаде, США и других европейских странах есть дома, построенные из СИП-панелей более 40 лет назад. Рассчитанный срок службы 80 лет.

Прочность

Дома из SIP-панелей выдерживают перепады температур от −60 до +60°С, максимальные снеговые нагрузки, ураганные ветры и землетрясения до 9 баллов. По долговечности и прочности они превосходят строения из бруса и бревна. Конструктивно они примерно в 4 раза прочнее (на сжатие и излом) деревянно-каркасных домов. За счет монолитного склеивания 1 панель шириной 1,25м, выдерживает вертикальную нагрузку 10 тонн и поперечную нагрузку 2 тонны на 1м2 (для строительства коттеджей достаточно 350 кг. на 1м2).

Отсутствие «мостиков холода»

«Мостики холода» исключаются благодаря оригинальному креплению панелей между собой, а так же использованию проставочных балок из СИП-панелей. Тем самым обеспечивается влагостойкость, устойчивость к гниению, плесени, атмосферным явлениям.

Огнестойкость

При отделке внутренних стен гипсокартоном предел огнестойкости конструкций составляет около 1 часа. Сама конструкция панелей не позволяет им деформироваться, но даже в случае их обрушения они не создают опасности для жизни людей из-за своего малого объемного веса.

Малый вес конструкции

Малый вес позволяет надстраивать этажи даже на деревянные дома без дополнительной нагрузки на фундамент.

Размер панели (мм)

Вес одной панели (кг)

Вес кв.м. (кг)

2500х1250х70

40,5

12,96

2500х1250х120

42,5

13,6

2500х1250х170

44,5

14,24

2500х1250х200

46,5

14,88

Сейсмостойкость

До 9 баллов.

Мобильность

Возможно перемещение сооружений с помощью крана.

Легкость монтажа

Отсутствует необходимость использования тяжелой строительной техники: весь комплект дома 150-200 м2 общей площади можно перевезти в 2 еврофурах, при этом непосредственно на монтаже самого дома практически не задействуются грузоподъемные механизмы, что позволяет строить дома в труднодоступных местах. Одновременно наша система может быть крайне эффективно использована при ликвидации чрезвычайных ситуаций.

Сертификация

СИП-панели сертифицированы органом по сертификации продукции в строительстве. Также на них получены гигиенический сертификат и сертификат пожарной безопасности.

Описание СИП-технологии

В основе северо-американской технологии строительства лежит использование конструкционной теплоизоляционной панели (КТП или SIP) для основных элементов здания: стен, перекрытий и кровельных конструкций. Необходимо отметить, что данная технология — это не каркасное, а панельное домостроение, т. е. при строительстве не используется отдельно возводимый каркас здания. Его роль выполняют верхний и нижний обвязочный брус панелей, а сами панели являются основным несущим элементом конструкции. Это значит, что Ваш дом будет не только основательно прочным, но и долговечным.

В настоящее время методика панельного домостроения считается одной из лучших по совокупности современных требований, предъявляемых к жилым домам во всем мире.

Панельные термодома не уступают домам деревянным и каменным, а в чем-то и превосходят их. Такие дома вызывают повышенный спрос благодаря их высокому архитектурному качеству, невысокой стоимости, большой долговечности и экономичности в эксплуатации. Именно в таких панельных домах проживает большая часть населения США, Канады, Норвегии, Финляндии, Германии.

Конструкция КТП (SIP) панели

Конструкционная теплоизоляционная панель состоит из двух ориентированных стружечных плит ОСП-3 (OSB-3), между которыми под давлением приклеивается слой твердого пенополистирола в качестве утеплителя. Толщина панелей в готовом виде составляет от 70 мм до 226 мм. Размеры панелей 2.5×1.25м или 2,8×1,25м. Такая панель обладает исключительными энергосберегающими свойствами и имеет высокую прочность. Стены и углы домов, собранных по этой технологии, идеально ровные и прямые. Кроме того, монтаж домов производится в любое время года, построенные дома долговечны и обладают отличными эксплуатационными характеристиками.

ОСП (OSB) — ориентированно стружечная плита

ОСП — спрессованная древесностружечная плита с ориентированной плоской щепой. Это первая плита древесного происхождения, разработанная специально для строительства. Прямоугольные узкие щепки толщиной 0,5 — 0,7мм. и длиной до 140мм. укладываются в три слоя, причем щепа в наружных слоях плиты располагается вдоль главной оси плиты, а во внутреннем слое — перпендикулярно главной оси. Благодаря такой ориентации плоской длинноразмерной щепы получается конструкционный материал с анизотропными свойствами — повышенной прочностью на изгиб и повышенной упругой прочностью вдоль главной оси плиты. Процесс прессовки проходит в условиях высокого давления и высокой температуры, с использованием водостойкой смолы. По сути, ОСП — это «улучшенная древесина» — более прочная и эластичная — за счет сохранения в плоской щепе всех полезных свойств массива древесины, при отсутствии таких дефектов как сучки и изменение направления волокон в связи с естественными условиями роста дерева. Связующая и специальная обработка поверхности обеспечивают водостойкость, устойчивость к гниению, плесени и атмосферным воздействиям, значительно превышающие сходные характеристики массива древесины.

Плиты ОСП устойчивы к изменению погодных условий (влажность, температура), легко пилятся, сверлятся и обрабатываются любым инструментом, предназначенным для работы с древесиной. Существенным отличием плит ОСП от других плитных материалов является то, что прочностные свойства и способность удерживать крепеж обеспечиваются характером укладки щепы — при нагружении в процессе эксплуатации длинные стрэнды передают нагрузку друг через друга, образуя единый конструкционный элемент, свободный от концентраторов напряжений, и сочетающий в себе высокую прочность с высокой эластичностью. Крепеж (шурупы, кольцевые гвозди, строительные скобы и пр.) удерживается многочисленными тонкими щепами, ориентированными в плоскости, перпендикулярной к оси крепежных элементов.

Традиционно основным материалом для производства плит ОСП является сосна или осина. Плиты ОСП содержат до 97% древесины — это одна из самых экологически чистых древесных плит — как в отношении производства, так и в отношении готовой продукции. Низкая доля связующего дает не только экологическую безопасность, но и все прочие полезные эксплуатационные и производственные свойства древесины — легкость (плотность плиты — около 650 кг/куб. м.), низкую теплопроводность, хорошее звукопоглощение, хорошую обрабатываемость и эстетичный внешний вид.

Важнейшее преимущество технологии — отличные энергосберегающие характеристики. Обеспечивается это, прежде всего, за счет пенополистирола.

Пенополистирол (ПСБ-С)

Это экологически чистый, нетоксичный тепло- и звукоизоляционный материал, применяемый в строительстве на протяжении уже 50 лет и зарекомендовавший себя как наиболее экономичный, удобный в применении и обладающий низкой степенью теплопроводности и паропроницаемости. В настоящее время в Европе более 60% всего производимого пенополистирола используется для целей теплоизоляции.

Пенополистирол является нейтральным материалом, не выделяющим никаких вредных для человека и его окружения веществ и не имеет ограниченного срока годности. Он экологичен в процессе работы с ним, а также весь период дальнейшей эксплуатации. Он не дает трещин, не является питательной средой для микроорганизмов, грызунов и другой живности, не загнивает, не плесневеет и не разлагается. Воздухопроницаемость позволяет зданию дышать.

Пенополистирол относится к той группе пластмасс, которые при горении выделяют точно такие же газы, как и при сжигании древесины или пробки. Современные пенопласты производят в огнестойком (самозатухающем) исполнении. Влага не влияет на теплоизолирующие свойства этого материала и не вызывает образование в нем бактерий и плесени, что позволяет широко использовать пенополистирол даже в пищевой промышленности. Пенополистирол устойчив к воздействию химических и биологических сред. Он отлично переносит присутствие асфальтовых эмульсий, рубероида с асфальтовым покрытием, искусственных удобрений, каустической соды, аммония, жидких удобрений, вспененных красок, мыла и смягчающих растворов, цемента, гипса, извести, растворов соли (в том числе морской воды) и всякого рода грунтовых вод.

Технология строительства домов из СИП панелей

Технология строительства домов из СИП панелей

Рассмотрим наиболее характерные особенности строительства домов из панелей СИП, благодаря которым сип-строительство наиболее выгодно отличается от других более классических методик возведения жилищ человека. И если в двух словах, то возведение дома из панелей СИП под ключ можно сравнить с неким строительным конструктором. И действительно: окна дома, сами сип-панели и каркас в основе — это самые настоящие элементы конструктора. А технология строительства — некая инструкция или, можно сказать, схема конструктора.

Характерные черты стройки на базе СИП

  • Стройка происходит на базе тщательно проработанного проекта. Если для дома из традиционных материалов — кирпичный, из пеноблоков, бруса — подойдёт даже простенький эскиз, скачанный из Интернета, то с сип-технологией всё гораздо основательнее. Всё дело в том, что проект, который подготавливается при подготовке к строительству дома по технологии СИП, содержит полные данные о всех элементах панелей, устанавливаемых на каркасную основу. Конечно, можно также строить, как говорится, на глаз. Но в этом случае, как показывает практика, существенно возрастает расход панелей. Порой — даже на десять-двадцать процентов. Именно поэтому такое внимание уделяется подготовительному этапе. А именно — основательной проработке проекта.
  • Дома из панелей СИП славятся своей высокой энергетической эффективностью. И всё из-за того, что в панелях СИП нет всевозможных микроскопических трещин, как в некоторых других материалах. Однако необходимо всё же внимательно обрабатывать все щели, возникающие в процессе стыковки панелей с каркасом. К сожалению, небольшие бригады строителей часто просто закрывают на это глаза.
  • Далее — фактор всепогодности. Дом легко возводится круглогодично. К примеру, часто летом возводят фундамент и продолжают стройку зимой. В среднем на полное возведение требуется около трёх недель. Причём в этот срок входит и подготовка свай, и обустройство крыши. Таких сроков удаётся добиться из-за применения современных технологий. Интересно, что по подсчётам специалистов, на возведение дома из СИП требуется гораздо меньше труда — экономия порой достигает пятидесяти процентов, если сравнивать с обычными каркасными домами. Важно, что подведением коммуникаций допустимо заниматься не только после окончания стройработ, но и даже до установки стен (однако нужно дать затвердеть фундаменту). А если используется фундамент свайно-винтового типа или свайно-ростверкового, то можно заниматься коммуникациями уже после установки стенового комплекта.
  • Обычно из СИП возводят строения в два этажа. Дом при этом оборудуется тёплым чердачным перекрытием. А также стропильной крышей с покрытием из металлочерепицы (либо применяется мягкая черепица). А вот в строении мансардного типа чердачное перекрытие не делают, крышу делают из тех же панелей СИП (то есть крыша тёплая). Однако есть ещё один вариант, когда крыша из панелей СИП заменяется на крышу стропильного типа, но при этом применяется утеплитель каменная вата (обычно — слой в двести миллиметров). Каменная вата — это один из самых эффективных теплоизоляторов.

Основные этапы строительства домов из панелей СИП

Подготовительный этап

Всё начинается с выбора места под строительство дома. Важно также уточнить, где север, а где юг. Обращают внимание и на уклон местности. После этого можно переходить к выбору эскиза дома. На этом этапе продумывают то, как будут проведены коммуникации.

В случае, если планируется возвести дом на базе старого фундамента, то необходимо основательно промерить фундамент. Уделить внимание всем диагоналям и перемычкам, чтобы избежать внесения правок на более позднем этапе. Рекомендуется, чтобы замеры проводили именно будущие строители дома.

Теперь можно переходить к заказу проекта. После того, как будут внесены все коррективы, нужно окончательно утвердить проект. Рекомендуется основательно подходить к проработке проекта, поскольку в этом доме Вам жить годами. Не лишним будет вовлечь в процесс утверждения проекта всех родных и близких, которые будут далее жить в будущем доме. Также на этапе тщательной проработки проекта быстро отфильтровываются строительные бригады, которые привыкли возводить дома «на глаз».

Обращаем Ваше внимание, что до финального утверждения проекта нельзя возводить фундамент. И стоит также вбить в землю пару колышков, которые укажут строителям, где будет располагаться фасад.

Заключаем договор

С бригадой строителей обязательно нужно заключить договор на основе проекта. В договоре нужно прописать такие пункты, как точное время старта работ, указать место, где будет жить бригада. А также нужно отразить в договоре моменты по подъезду и другие важные вещи, которые влияют на процесс строительства. Теперь несколько слов о стройматериалах — обычно стройматериалы полностью поставляются строительной фирмой. Потому что снимаются многие вопросы — к примеру, о качестве и номенклатуре товаров. К тому же, часто это просто выгодно финансово. Также комплектующие должны поставляться с определённым процентом в плане отходов. Этот момент влияет на качество конструкции.

Важное примечание — как только Вы заключили договор со строителями, ни Вы, ни строители теперь не имеете права что-то менять в проекте. Поскольку именно такие изменения по ходу работ часто приводят к неудовлетворительным результатам, юридической неопределённости и плохим отношениям между сторонами. Особенно внимательно нужно относиться к ситуациям, когда сами строители предлагают внести какие-то изменения в проект по ходу основных работ. Конечно, в проекте действительно может быть ошибка. Но как показывает практика, чаще всего таким образом строители пытаются избежать части работ по причине непонимания некоторых нюансов строительства или в целях экономии времени.

Устраиваем фундамент

Чаще всего применяется фундамент из винтовых свай. Что можно сказать про такой фундамент? Он современный и действительно хорош для не сильно тяжёлых строений. При этом такой фундамент: легко установить хоть летом, хоть зимой; он подходит для практически любого грунта; отличается долговечностью, экологичностью, лёгкой установкой на требуемую высоту и не загрязняет участок. Как правило, сваи ввинчивают несколько ниже, чем глубина промерзания. Далее их обрезают на фиксированном уровне. После этого происходит заливка бетоном. И в финале — закрытие оголовками. Также сваи иногда связывают друг с другом уголками (или другим профилем), приваривая перемычки горизонтально и вертикально — в случае, если сваи возвышаются над землей более, чем на семьдесят сантиметров. В общем, винтовые сваи — это экономически выгодно, популярно, всепогодно, легко и просто в установке.

Хотя иногда применяется и фундамент ленточного типа. А также ростверк + буронабивные сваи. В целом, для строительства дома из  СИП панелей можно использовать практически любой фундамент. Конечно, при этом разные виды фундаментов могут существенно отличаться по цене, оперативности постройки и некоторым другим характеристикам.

Объединяем сваи с помощью цокольной обвязки

С помощью цокольной обвязки строители объединяют сваи в цельную систему или, можно сказать, конструкцию. Часто для этого применяется брус двести на двести. Поскольку состыковать брус можно непосредственно над сваей, на этом этапе работ получается повышенное количество отходов. Брус обычно соединяют «в половину дерева» и фиксируют между собой и к фундаменту специальными скобами, а также, так называемыми, «глухарями» (особыми болтами). Часто получается, что над сваей соединяют три-четыре оконечника бруса. Все деревянные элементы этой части дома также обязательно нужно пропитать специальными составами, повышающими стойкость конструкции к огню и гниению. При этом применяется гидроизоляция — если фундамент из бетона, то двойная и рулонная. Всё это во многом влияет на то, сколько простоит возводимый дом в принципе.

Итак, чаще всего применяется фундамент из винтовых свай и используется цокольная обвязка. Причём обвязка — точно горизонтальная. Все углы должны быть прямыми, а размеры — соответствовать документации.

Цокольное перекрытие

Реализуется с помощью сип-панелей, а между ними — брус для соединения. Периметр также делается из бруса (типа торцевого). Соединительный брус должен быть в толщину сто миллиметров. А торцевой — полсотни миллиметров. При этом цокольное перекрытие должно быть толще стен на 50 миллиметров. Перекрытие должно быть надёжно закреплено на обвязочном поясе с помощью длинных саморезов. Обычно также балки обвязки и низ сип-панелей из перекрытия покрывают антисептическим составом и/или мастикой на основе битума.

Возводим внешние стены, а также перегородки

На этом этапе нужно правильно определить отступ стен на перекрытие, установить направляющий брус, поместить в него панели. Обычно монтаж сип-стен начинают в углу. При этом начальная панель должна быть установлена вертикально от угла. Далее к ней не менее строго вертикально нужно подсоединить очередную панель. После этого устанавливаются остальные стены — ни на миллиметр не отходя от проекта. На местах дверей и окон устанавливаются вертикальные стойки по всей высоте стены — получаются пустые проёмы. При этом обычно допуски по дверям и окнам минимальные — поскольку отсутствует усадка и высока точность в плане установки сип-панелей.

Соединения внешних стен должны быть посажены на пену, которая при этом немного высовывается между OSB. А если осуществляется подрезка панели, то необходимо снова подготовить пазы под брус с помощью специального инструмента (на базе нагретой проволоки). Общее правило — стоит избегать узких элементов из панелей, а также лишних стыков. Пусть в этом случае можно сэкономить на материалах, но из-за этого уменьшается теплосопротивление.

Также обычно последнюю панель подрезают, тем самым компенсируя неточности, технологически особенности OSB в плане зазоров и другие расхождения в размерах. А если финальная панель устанавливается целой, то нужно подрезать предыдущую.

Как только установлены стены, можно переходить к сбору перегородок на базе менее толстых панелей СИП. Это наиболее распространённый вид перегородок, поскольку таким образом получается сэкономить. В результате всё должно быть запенено с верхней стороны и зашито брусом.

Перекрытие между этажами

Перекрытие играет роль звукоизоляции между первым и вторым этажом, а также перекрытие выступает несущей конструкцией относительно перегородок на втором этаже. Чаще всего применяется перекрытие трёх типов:

  • сип-панели 224 на 625 миллиметров;
  • деревянные балки 100 на 200 миллиметров в сечении;
  • двутавровые балки (240 миллиметров).

Про первый вариант можно сказать, что он максимально технологичен. Второй вариант — максимально экономный. Третий вариант — подходит для перекрытия наиболее длинных пролётов и в тех случаях, когда требуется повышенная жёсткость. Однако если пролёты превышают 4,5 метров, то под перекрытием нужно дополнительно установить жёсткие балки типа LVL, так называемые, ригели.

В любом случае, вариант перекрытия должен быть определён ещё на этапе создания проекта. Поскольку на конкретный выбор существенное влияние оказывает планировка.

Перекрытие для чердака + стропильная крыша

В случае, если подразумевается верхний этаж, то он должен быть завершён специальным теплым перекрытием на основе СИП-панелей. А над ними — стропильная крыша (холодная). Это наиболее выгодный вариант, поскольку дом получается тёплым, а условия эксплуатации крыши — оптимальные.

При этом обычно применяются сип-панели 625 мм в ширину и стандартный брус (соединительный и закладной). Также если того требует проект, можно сделать люк из панелей.

Для установки стропильной системы применяются обычные правила, боковые прогоны и подкосы. Заподлицо внешнего края перекрытия крепится мауэрлат. Который также пришивается к брусу.

Крыша для мансардного этажа

В случае, если проект Вашего дома подразумеваем возведение мансардного этажа, то для сборки крыши применяются панели СИП с шириной, равной 625 миллиметрам. Что позволяет создать правильный тепловой контур у Вашего дома. Также в этом случае нельзя устанавливать стропильную систему и утеплитель из минваты. Потому что вата не защищает от прохождения воздуха. В результате чего нарушается тепловой контур и нивелируется вся польза от панелей СИП в плане сохранения тепла.

Следующие работы

Как только строительство завершено, можно переходить к этапу отделки. При этом для сип-домов характерна низкая цена и невысокая трудоёмкость отделки из-за ровности стен. Также для облицовки фасада обычно не используется специальный утеплитель либо панели из нескольких слоёв. Однако не нужно забывать, что в большинстве случаев отделка не стоит дешевле самого строительства. Пусть сип-дома в этом плане и выгодно отличаются от классических кирпичных или пенобетонных строений. Советуем Вам делегировать отделку и реализацию инженерных систем той фирме, которая непосредственно работает с сип-домами. Избегая «горе-мастеров», берущихся за дело, абсолютно не владея нужными знаниями.

Этапы строительства дома из СИП-панелей по канадской технологии

Знаменитая канадская SIP-технология насчитывает более 50 лет, и на сегодняшний день, является наиболее прогрессивной. В сфере малоэтажного строительства она считается одной из лучших! Основана она на применении SIP-панелей , обладающих высокими теплоизоляционными качествами.

В настоящее время SIP-технологии имеют широкое распространение, а дома из SIP- панелей  превосходно прошли все испытания в самых разных странах Европы и Америки, после которых купить дом из сип панелей стало престижно и модно. Они выдерживают различные климатические условия и ни в чем не уступают домам из традиционных материалов, а по энерго- и теплоизоляции заметно их превосходят. Купить дом из сип панелей теперь стало еще доступней, и благодаря современным технологиям — еще и экономней по сравнению со стандартными домами. Стандартный кирпичный или деревянный дом в морозы требует энергозатрат 3-6 раз больше, нежели коттедж, построенный по SIP-технологии. Если купить дом из сип панелей, вложения в теплозащиту окупаются в течение первых лет эксплуатации. Мы строим сип дома под ключ только по проверенным технологиям.

Давайте рассмотрим все этапы строительства:

Монтаж фундамента 

Предлагаем несколько видов фундамента:

  • фундамент на винтовых сваях, сваях ЖБИ
  • УШП плита 
  • ленточный фундамент.

Возведение сип дома  начинается с обустройства фундамента , который может быть возведен на любых видах почв — фундамент на винтовых сваях, сваях ЖБИ.

Это относительно недорогое основание для конструкции дома, дешевле бетонного на 30-70%. На установку фундамента сип дома у наших строителей уходит всего 1-2 дня.

Монтаж обвязки фундамента брусом  и гидроизоляция низа сип-панелей для нулевого перекрытия.

Следующий этап строительства сип дом —  установка нижнего обвязочного бруса и гидроизоляция панелей, требующая особого внимания, поскольку дальнейшая сборка и качество дома во многом зависит от точности этой работы. 

Обвязка брусом Гидроизоляция SIP-панелей

Сборка стен 1-го этажа

Затем с установки 2-х угловых панелей начинается сборка стен первого этажа, после чего в нижней обвязке делают вырезы под дверные проемы. Стены имеют маркировки и монтируются в соответствии со схемой их расположения. Положение стен проверяется с помощью отвеса. Последовательная установка стоек и панелей продолжается в обе стороны от 1-го угла по периметру здания и в его внутренних помещениях. Выборки в пенополистироле обрабатываются монтажной пеной еще до установки SIP-панели.

Сборка стен других этажей

По завершении сборки 1-го этажа, аналогично проводится сборка стен 2-го и последующих этажей, сборка межэтажного и чердачного перекрытий.

Сборка крыши

С установки силовых элементов несущих конструкций начинается сборка крыши и монтаж стропильной системы. Завершается сборка дома установкой крыльца. После этого этапа строительства уже можно купить дом из сип панелей.

Канадская технология строительства каркасных домов

05.09.2018
Строительная технология компании VIVA HAUS основана на использовании каркасной технологии строительства из СИП-панелей Structural Insulated Panel (SIP).
Эти структурированные изоляционные панели применяются для строительства основных элементов здания: полов, стен, перекрытий и кровли.

Считается, что эта технология была создана в Канаде. Впервые здания, построенные по технологии SIP, появились в Канаде больше 40 лет назад и с тех пор не утратили своей популярности. Постепенно эта каркасная технология стала использоваться в США, Скандинавских странах, Германии и других европейских странах. Однако следует отметить, что ещё в 1952 году технология СИП успешно использовалась при строительстве советских полярных станций в Антарктиде.

Более того, первые домики полярников Арктики, сделанные по SIP технологии, успешно дрейфовали на льдинах ещё до Великой Отечественной Войны. Единственное отличие заключалось в том, что в Советском Союзе, вместо OSB использовалась бакелитовая авиационная фанера, в основе которой содержались фенолформальдегидные смолы. В СССР производство пенополистирола (марки ПС-1) было освоено еще в 1939 г.

Основополагающим элементом канадской каркасной технологии, является сендвич-панель, которая изготовлена по специальной технологии. Оптимально достаточная толщина панели составляет 174 мм.

Эти 174 мм состоят из трех слоев:

  • Два внешних слоя, это две ориентировано-стружечные плиты OSB-3, состоящие из плоской древесной щепы, спрессованной под высоким давлением. Древесная щепа скрепляется между собой натуральными древесными смолами с экологически чистыми отвердителями. По сравнению с обычной древесиной, плита OSB-3 обладает лучшими конструкционными свойствами, более эластичная, меньше подвержена воздействию биопатогенной микрофлоры. Высокое давление и натуральные смолы, используемые при изготовлении плиты OSB-3, обеспечивают отсутствие внутренних дефектов, а экологически чистые отвердители обеспечивают повышенную пожаростойкость.
  • Третий слой, помещенный между листами OSB-3, это слой вспененного пенополистирола производства Knauf. Не смотря на то, что 98% пенополистирола составляет воздух, находящийся между шариками, из которых он состоит, пенополистирол обладает достаточно высокими конструктивными свойствами на сжатие за счет упругости каждого отдельного шарика, заполненного инертным к горению газом. Сам вспененный пенополистирол, является экологически чистым материалом. Экструдированный пенополистирол высокой плотности активно используется в пищевой промышленности. Этот слоеный «пирог» склеиваться на автоматизированных прессах высокого давления с использованием экологически чистых и высокопрочных клеевых компонентов. Эта композиция позволяет получить легкую и прочную конструкционную панель, обеспечивающую высокую прочность на сжатие и разрыв, и прекрасные теплоизоляционные и звукоизоляционные свойства.
Эта комбинация делает помещения хорошо изолированными от температуры снаружи, сохраняя высокую прочность стен и других элементов на сжатие и разрыв.

Описание основных характеристик канадской технологии

Теплоизоляция
Дома, построенные компанией VIVA HAUS, всегда сохраняют комфортную температуру. В них тепло в зимние морозы и прохладно жарким летом.

Жилье, построенное по каркасной СИП технологии компанией VIVA HAUS, сохраняет температуру внутри помещения в 16 раз лучше, чем аналогичное жилье, построенное из кирпича. Приведем следующий пример: СИП-панель компании VIVA HAUS толщиной 174 мм по теплоизоляционным свойствам полностью соответствует 600 мм сухого дерева, 1160 мм пенобетона, 2900 мм кирпича и 4000 мм бетона. Впечатляет, не правда ли? Благодаря высоким теплоизоляционным свойствам СИП-панелей, расходы на отопление домов от компании VIVA HAUS значительно меньше стандартных, а значит, в долговременной перспективе Вы сможете немало сэкономить. Прогрев дом до оптимальной температуры, Вы можете смело отключать отопление. Испытания показывают, что температура, внутри помещения, в зависимости от остекления дома, падает всего на 1-3 градуса в течение суток.

У канадской технологии строительства из СИП панелей есть престижный сертификат Energy Star, вручаемый лучшим энергосберегающим технологиям.

Темпы строительства
Еще одно преимущество технологии СИП — высочайшая скорость строительства дома. К примеру, коттедж общей площадью 150м2 можно возвести за 2 недели.

Современные высокоточные форматно-раскроечные станки, установленные на заводе VIVA HAUS, обеспечивают безупречную точность изготовления сендвич-панелей, что гарантирует высокую скорость монтажа дома. Каждая готовая сэндвич-панель тестируется, а затем маркируется на заводе VIVA HAUS. Легкий вес СИП панелей еще больше способствует скорости монтажа. Вес элемента не превышает 50 кг, что, в свою очередь, делает проще и дешевле доставку сандвич панелей к месту строительства. Для возведения дома не нужна тяжелая техника, достаточно квалифицированной бригады специалистов из 3-4 человек. Отсутствие тяжелой техники при строительстве дома, позволяет весьма существенно экономить средства и сохранять природный ландшафт участка.

В строительстве по каркасной технологии СИП отсутствуют «мокрые» процессы, что позволяет строить дом в любое время года без изменения стоимости строительства. Дом из панелей, изготовленных по технологии СИП (SIP), может возводиться зимой при низких температурах, что убедительно было продемонстрировано при строительстве Антарктических полярных станций, особенно станции «Восток».

Канадские дома, изготовленные по технологии SIP, не подвержены усадке, следовательно, двери и окна могут быть смонтированы сразу после окончания строительства здания. Это позволяет сразу же заселиться в дом и заняться внешней и внутренней отделкой.

Звукоизоляция
Благодаря свойствам панелей, изготовленным по технологии SIP компанией VIVA HAUS, проникающий шум снижается до минимума. Панели не только удерживают тепло, но и отражают большую часть волновых колебаний, то есть отражают большую часть внешних звуков. В числовых характеристиках это выглядит так: звукоотражение 70дб, которое дают СИП (SIP) панели толщиной 174 мм, аналогично звукопоглощению кирпичной стены толщиной 250 мм. Панели, изготовленные по технологии SIP, обеспечивают прекрасную внутреннюю акустику помещения, практически полностью препятствуя проникновению звуков в соседние помещения.

Экологичность
СИП панели соответствуют уровню эмиссии Е1, что является очень хорошим показателем. То есть, изготовленная на заводе СИП панель, аналогична обработанному антисептиком сухому пиломатериалу.

Класс Е1 означает, что содержание вредных формальдегидов в СИП панели, практически отсутствует.

Экологически чистый состав СИП панели не вызывает абсолютно ни каких сомнений. Как уже было сказано, OSB плита, это крупная щепа(90%), соединенная природной смолой и экологически чистым отвердителем. Щепа для панелей OSB изготавливается из экологически чистой здоровой древесины (в основном стволов малого диаметра). Пенополистирол производства Knauf, и высокопрочный клей, которым склеиваются СИП панели компании VIVA HAUS, так же имеют экологический сертификат.

Огнестойкость
В плане огнестойкости, каркасный дом, изготовленный из СИП панелей, относиться к классу К3 конструктивной пожарной безопасности. К этому же классу относятся и любые другие дома изготовленные из древесины. Следует отметить, что дома, изготовленные по технологии СИП компанией VIVA HAUS, меньше подвержены возгоранию, чем дома из дерева. Это связанно с тем, что плита OSB имеет большую плотность, чем сухая древесина, из которой плита OSB изготовлена, а экологически чистые смолы и отвердители, связывающие щепу в панели, являются не горючими. Пенополистирол Knauf, запрессованный между панелями OSB, относится к разряду самозатухающих. Подобная композиция, делает SIP панель от VIVA HAUS значительно менее горючей, чем древесина, а особенно сухая древесина, вспыхивающая как порох.

Требования к фундаменту 
Многолетний опыт нашей компании, основанный, как на практике, так и на глубоком изучении предыдущего наследия в строительстве фундаментов, позволяет нам конкретно указать на самые подходящие для этого типа домов фундаменты. Это свайно-винтовой фундамент или, в наиболее сложных случаях, монолитная плита.

В отдельных случаях (наличие в доме подвала, или каменистый грунт в основании дома), может применяться столбчатый, или ленточный фундамент. Остановимся подробнее на тех типах фундамента, которые наиболее подходят для домов, построенных по SIP технологии.


Свайно-винтовой фундамент



Относительно небольшой вес канадских домов, построенных из СИП панелей компанией VIVA HAUS, позволяет использовать свайно-винтовой фундамент на сваях среднего диаметра (обычно 108 мм), вместо громоздкого фундамента иного типа.

Свайно-винтовая конструкция используется для 70% возводимых компанией VIVA HAUS зданий. Винтовая свая представляет собой трубу из высокопрочной стали с приваренной к ней лопастью определенной конфигурации. Поверхность трубы обрабатывается антикоррозийным составом, который используется, в том числе, для покрытия ледоколов.

Для возведения фундамента дома, сваи ввинчиваются в грунт на глубину не менее 2-х метров. Расстояние между сваями устанавливается согласно утвержденному проекту. Установленные сваи выравнивают по вертикали и горизонтали, после чего бетонируют.

После заливки бетоном, на сваи навариваются оголовки, на которых и будет стоять Ваш будущий дом. Подготовленное таким образом свайное поле, обвязывают фундаментным брусом с сечением 200х200 мм. В отдельных случаях используется фундаментный брус иного сечения.

Особенно следует отметить, что долговечность свайного фундамента, напрямую зависит от качества свай, их последующего бетонирования, а так же от глубины закручивания свай в грунт. Компания VIVA HAUS гарантирует точное соблюдение всех технологических процессов при изготовлении свайного поля, а так же и само качество свай.

Фундаменты свайно-винтового типа не могут быть использованы на каменистых и болотистых грунтах. Для этого типа грунтов используются иные виды фундаментов.


Кровля 
Крыша и кровля являются очень важными элементами каркасного дома изготовленного по канадской технологии. От качества их проектирования и строительства во многом зависит не только прочность здания и его способность противостоять атмосферным осадкам, но и энергоэффективность всей постройки в целом. Крыша и кровля, являются одними из основных архитектурных элементов, формирующих внешний облик всего здания в целом, предавая ему тот или иной законченный вид.

Компания VIVA HAUS предлагает разнообразные формы крыш: мансардные, сводчатые, вальмовые, шатровые, плоские и так далее, а так же разнообразные виды кровли, способные удовлетворить самого изысканного заказчика. Разумеется, при выборе крыши и кровли необходимо учитывать природные условия региона и архитектурный стиль дома. Стоит обратить внимание на тот факт, что крыша и кровля с эксплуатационными возможностями, стоят несколько дороже обычных. 

Канадские дома изготовленные по СИП технологии компанией VIVA HAUS имеют преимущественно скатные крыши. Стандартное покрытие кровли делается из наплавляемых рулонных материалов. Из обычной плоской крыши компания VIVA HAUS вполне может сделать эксплуатируемую инверсионную крышу, которая может использоваться на манер открытой площадки для пикника, или принятия солнечных ванн в летнее время года. Среди предлагаемых компанией VIVA HAUS кровельных материалов наибольшей популярностью пользуется различные виды черепицы (на выбор несколько десятков материалов различных производителей), фальцевая кровля и волнистый лист.

Идеальная кровля должна быть надежной долговечной и современной — технологии производства покрытий для крыши не стоят на месте. Эстетическая составляющая кровли, ее текстурная, фактурная и цветовая гамма, соответствие цветовой гамме дома и окружающих дом построек, играет важную роль при выборе кровли. Подобный подход к вопросу позволяет идеально вписать дом в окружающий ландшафт, сделав композицию, в целом, крайне привлекательной. Фактически, выбирая кровельный материал, Вы берете на себя роль дизайнера-творца.

Долговечность
Как бы ни был хорош исходный материал, на продолжительность срока службы дома влияют грамотно созданный архитекторский проект и качество постройки дома. От того насколько профессионально сделан проект, насколько профессионально по этому проекту построено здание, в прямую зависит его долговечность. Сложно судить о долговечности здесь и сейчас, но, по нашим данным, дома, возведенные по канадской технологии в пятидесятые годы прошлого века в Антарктиде, успешно стоят, и по сей день. Приведем в пример фахверковые дома, конструкция которых аналогична технологии SIP. Даже те дома, которые были возведены 500 лет назад, продолжают стоять, радуя глаз своею строгой красотой.


Технология изготовления SIP-панелей | КРАПАН

Технология СИП-строительства предлагает качественные решения для жилых и малоэтажных нежилых зданий. СИП-панели используются при строительстве коттеджей и дачных домов различного типа, реконструкции старых зданий, при надстройке мансардных этажей. Выбирая технологию строительства из СИП-панелей – означает сделать первый и самый важный шаг в создании максимального комфорта и улучшении качества своей жизни. Мы предложим Вам большой выбор проектов, а также поможем создать Ваше уникальное дачное гнездышко, а цена дома из СИП-панелей Вас приятно удивит и поможет сэкономить на строительных материалах и отделке.

Дома из сип панелей – это уютные дома с минимальными затратами. Основными преимуществами такой постройки выступают уникальные эксплуатационные качества, такие как сейсмоустойчивость, звукоизоляция, устойчивость к влаге и морозам. СИП панели, которые мы предлагаем купить в нашей компании, сертифицированы в соответствии с международными стандартами.

Преимущества  СИП-технологии

  • внутренние коммуникации монтируются аналогичко каменым домам;
  • возможность использования всех наружных и внутренних отделочных материалов;
  • возможность применения разнообразных архитектурных форм;
  • высокие энергосберегающие и экологические свойства жилья;
  • здание долговечно, кроме того его легко реконструировать;
  • идеальные поверхности пола, стен и потолков для высококлассной отделки помещений;
  • лучшее соотношение цена/качество;
  • отсутствие «мостиков холода» в конструкции здания;
  • повышенная устойчивость здания к просадкам;
  • не требуется тяжелые подъемные механизмы;
  • устойчивость готового здания к атмосферным влияниям;
  • эффективность использования застраиваемой площади.

Из чего состоит дом?

Фундамент

Строительные нормы рекомендуют закладывать фундаменты на глубину промерзания грунта. Сооружение фундамента на такой глубине сопряжено с большим объемом земляных работ, и соответственно, со значительными расходами. За счет легкости конструкций из СИП-панелей значительно уменьшается нагрузка на фундамент и появляется возможность удешевить его. При проектировании и строительстве зданий из СИП-панелей наиболее целесообразно использовать винтовой (сваи) или столбчатый железо-бетонный фундамент, который позволяет значительно сократить расход материалов и снизить трудозатраты. Такие фундаменты является надежными и экономически оправданными.

Темпы строительства

Бригада из трех человек собирает дом 150м2 за 30 дней. Задержки возможны при неблагоприятных погодных условиях (метель, ливень, ураган и т.д.).

Затраты на отопление

В 5 — 6 раз меньше, чем на отопление стандартного кирпичного дома (коэффициент сопротивления теплопередаче пенополистирола составляет 0,041 Вт/мК, что в 20 раз меньше подобного показателя кирпичной стены). Практика показала, что при температуре снаружи дома до -25С — затраты электроэнергии на отопление в среднем 600кВт в месяц.

Экологическая чистота

В развитых странах мира из пенополистирола строят больницы, дома для престарелых, а ведь к этим зданиям предъявляются требования выше обычных. Даже люди с аллергией и астмой специально строят себе дома из этого материала.

Долговечность

Благодаря уникальным свойствам OSB–3 (применяется синтетический воск, добавляются соли борной кислоты) и ЦСП (цементно-стружечная плита) — увеличиваются защитные свойства плиты. Панели не подвержены впитыванию влаги, гниению, а так же обладают высокой устойчивостью к перепадам температуры от – 50 до + 50°С. В Финляндии, Канаде, США и других европейских странах есть дома, построенные из СИП-панелей более 40 лет назад. Рассчитанный срок службы 80 лет.

Прочность

Дома из СИП-панелей выдерживают перепады температур от −60 до +60°С, максимальные снеговые нагрузки, ураганные ветры и землетрясения до 9 баллов. По долговечности и прочности они превосходят строения из бруса и бревна. Конструктивно они примерно в 4 раза прочнее (на сжатие и излом) деревянно-каркасных домов. За счет монолитного склеивания 1 панель шириной 1,25м, выдерживает вертикальную нагрузку 10 тонн и поперечную нагрузку 2 тонны на 1м2 (для строительства коттеджей достаточно 350 кг. на 1м2).

Отсутствие «мостиков холода»

«Мостики холода» исключаются благодаря оригинальному креплению панелей между собой, а так же использованию проставочных балок из СИП-панелей. Тем самым обеспечивается влагостойкость, устойчивость к гниению, плесени, атмосферным явлениям.

Огнестойкость

При отделке внутренних стен гипсокартоном предел огнестойкости конструкций составляет около 1 часа. Сама конструкция панелей не позволяет им деформироваться, но даже в случае их обрушения они не создают опасности для жизни людей из-за своего малого объемного веса.

Малый вес конструкции

Малый вес позволяет надстраивать этажи даже на деревянные дома без дополнительной нагрузки на фундамент.

Так вес СИП панелей из OSB-3 приведен в таблице ниже.

 

Размер панели (мм) Вес одной панели (кг)
2500х1250х94 54
2500х1250х124 57
2500х1250х174 63
2500х1250х224 67
2800х1250х94 64
2800х1250х124 68
2800х1250х174 74
2800х1250х224 79

 

СИП-панели из листа ЦСП (цементно-стружечная плита), негорючие, не требуют отделки гипсокартоном.

 

Размер панели (мм) Вес одной панели (кг)
2500х1200х90 105
2500х1200х120 109
2500х1200х170 114
2500х1200х220 119

Сейсмостойкость

За счет деревянного каркаса — здания выдерживают до 9 баллов.

Мобильность

Возможно перемещение сооружений с помощью крана.

Легкость монтажа

Отсутствует необходимость использования тяжелой строительной техники: весь комплект дома 150-200 м2 общей площади можно перевезти в 2 еврофурах, при этом непосредственно на монтаже самого дома практически не задействуются грузоподъемные механизмы, что позволяет строить дома в труднодоступных местах. Одновременно наша система может быть крайне эффективно использована при ликвидации чрезвычайных ситуаций.

Сертификация

Все материалы применяемые для изготовления СИП-панели сертифицированы органом по сертификации продукции в строительстве. Также на них получены гигиенический сертификат и сертификат пожарной безопасности.

Описание СИП-технологии

В основе северо-американской технологии строительства лежит использование конструкционной теплоизоляционной панели (КТП или SIP) для основных элементов здания: стен, перекрытий и кровельных конструкций. Необходимо отметить, что данная технология — это не каркасное, а панельное домостроение, т. е. при строительстве не используется отдельно возводимый каркас здания. Его роль выполняют верхний и нижний обвязочный брус панелей, а сами панели являются основным несущим элементом конструкции. Это значит, что Ваш дом будет не только основательно прочным, но и долговечным.

В настоящее время методика панельного домостроения считается одной из лучших по совокупности современных требований, предъявляемых к жилым домам во всем мире.

Панельные термодома не уступают домам деревянным и каменным, а в чем-то и превосходят их. Такие дома вызывают повышенный спрос благодаря их высокому архитектурному качеству, невысокой стоимости, большой долговечности и экономичности в эксплуатации. Именно в таких панельных домах проживает большая часть населения США, Канады, Норвегии, Финляндии, Германии.

Конструкция КТП (SIP) панели

Конструкционная теплоизоляционная панель состоит из двух листовых материалов OSB-3, СМЛ или фибролит, между которыми под давлением приклеивается слой твердого пенополистирола в качестве утеплителя. Толщина панелей в готовом виде составляет от 70 мм до 226 мм. Размеры панелей 2.5×1.25м или 2,8×1,25м. Такая панель обладает исключительными энергосберегающими свойствами и имеет высокую прочность. Стены и углы домов, собранных по этой технологии, идеально ровные и прямые. Кроме того, монтаж домов производится в любое время года, построенные дома долговечны и обладают отличными эксплуатационными характеристиками.

ОСП (OSB) — ориентированно стружечная плита

ОСП — спрессованная древесностружечная плита с ориентированной плоской щепой. Это первая плита древесного происхождения, разработанная специально для строительства. Прямоугольные узкие щепки толщиной 0,5 — 0,7мм. и длиной до 140мм. укладываются в три слоя, причем щепа в наружных слоях плиты располагается вдоль главной оси плиты, а во внутреннем слое — перпендикулярно главной оси. Благодаря такой ориентации плоской длинноразмерной щепы получается конструкционный материал с анизотропными свойствами — повышенной прочностью на изгиб и повышенной упругой прочностью вдоль главной оси плиты. Процесс прессовки проходит в условиях высокого давления и высокой температуры, с использованием водостойкой смолы. По сути, ОСП — это «улучшенная древесина» — более прочная и эластичная — за счет сохранения в плоской щепе всех полезных свойств массива древесины, при отсутствии таких дефектов как сучки и изменение направления волокон в связи с естественными условиями роста дерева. Связующая и специальная обработка поверхности обеспечивают водостойкость, устойчивость к гниению, плесени и атмосферным воздействиям, значительно превышающие сходные характеристики массива древесины.

Плиты ОСП устойчивы к изменению погодных условий (влажность, температура), легко пилятся, сверлятся и обрабатываются любым инструментом, предназначенным для работы с древесиной. Существенным отличием плит ОСП от других плитных материалов является то, что прочностные свойства и способность удерживать крепеж обеспечиваются характером укладки щепы — при нагружении в процессе эксплуатации длинные стрэнды передают нагрузку друг через друга, образуя единый конструкционный элемент, свободный от концентраторов напряжений, и сочетающий в себе высокую прочность с высокой эластичностью. Крепеж (шурупы, кольцевые гвозди, строительные скобы и пр.) удерживается многочисленными тонкими щепами, ориентированными в плоскости, перпендикулярной к оси крепежных элементов.

Традиционно основным материалом для производства плит ОСП является сосна или осина. Плиты ОСП содержат до 97% древесины — это одна из самых экологически чистых древесных плит — как в отношении производства, так и в отношении готовой продукции. Низкая доля связующего дает не только экологическую безопасность, но и все прочие полезные эксплуатационные и производственные свойства древесины — легкость (плотность плиты — около 650 кг/куб. м.), низкую теплопроводность, хорошее звукопоглощение, хорошую обрабатываемость и эстетичный внешний вид.

Важнейшее преимущество технологии — отличные энергосберегающие характеристики. Обеспечивается это, прежде всего, за счет пенополистирола.

ЦСП плита

Имеет плотность от 950-1100 кг/м3, не горючия, устойчива к влажным и сырым помещениям, блогодаря изменённому соотношению хлорида и оксида магния в своём составе. Материал более прочен и слабо подвержен изменениям и колебаниям температурно-влажностного режима (влагонасыщение, выделение растворимых солей  в водной среде, разрушение внутренней структуры в результате сублимации).  Построенный дом из ЦСП панелей не требует дополнительной отделки гипсокартоном, что значительно экономит Ваш бюджед по отделочным работам.

Пенополистирол (ПСБ-С)

Это экологически чистый, нетоксичный тепло- и звукоизоляционный материал, применяемый в строительстве на протяжении уже 50 лет и зарекомендовавший себя как наиболее экономичный, удобный в применении и обладающий низкой степенью теплопроводности и паропроницаемости. В настоящее время в Европе более 60% всего производимого пенополистирола используется для целей теплоизоляции.

Пенополистирол является нейтральным материалом, не выделяющим никаких вредных для человека и его окружения веществ и не имеет ограниченного срока годности. Он экологичен в процессе работы с ним, а также весь период дальнейшей эксплуатации. Он не дает трещин, не является питательной средой для микроорганизмов, грызунов и другой живности, не загнивает, не плесневеет и не разлагается. Воздухопроницаемость позволяет зданию дышать.

Пенополистирол относится к той группе пластмасс, которые при горении выделяют точно такие же газы, как и при сжигании древесины или пробки. Современные пенопласты производят в огнестойком (самозатухающем) исполнении. Влага не влияет на теплоизолирующие свойства этого материала и не вызывает образование в нем бактерий и плесени, что позволяет широко использовать пенополистирол даже в пищевой промышленности. Пенополистирол устойчив к воздействию химических и биологических сред. Он отлично переносит присутствие асфальтовых эмульсий, рубероида с асфальтовым покрытием, искусственных удобрений, каустической соды, аммония, жидких удобрений, вспененных красок, мыла и смягчающих растворов, цемента, гипса, извести, растворов соли (в том числе морской воды) и всякого рода грунтовых вод.

Vulture | Кинематографическая вселенная Marvel вики

Гриф

Адриан Тумс — бывший владелец Bestman Salvage, базирующийся в Нью-Йорке, который решил стать преступником после того, как потерял все средства к существованию после создания Damage Control, совместного предприятия между федеральным правительством и Тони Старком. Вербовав своих сотрудников и экипировав себя летающим экзокостюмом, созданным с использованием украденной им технологии Читаури, Тумс взял на себя личность Vulture , а затем провел следующие четыре года, крадя современное вооружение для продажи на их черном рынке. Шокер и Тинкерер.Однако, поскольку незаконные действия Тоумса были замечены Человеком-пауком, Тоумс был вынужден выследить молодого героя. Во время финального столкновения Человек-паук победил Стервятника, прежде чем спасти его жизнь, и в знак благодарности Тумс отказался раскрыть истинную личность Человека-паука всем своим заключенным, включая Мак Гаргана, в тюрьме.

Биография

Бестман Утиль

Воспитание семьи
«Неплохо, правда?»
«Нет, да. У ребенка есть будущее.»
» Ага, ну … посмотрим, наверное. «
— Адриан Тумс и Финеас Мейсон [src]

Адриан Тумс женился на Дорис, и вместе у них родилась дочь Элизабет «Лиз» Тумс. Чтобы содержать свою семью, Тоумс основал клининговую компанию Bestman Salvage в Нью-Йорке. Тумс обнаружил, что его дочь обладает природным талантом к искусству, как и в детстве, что заставило его гордиться тем, что он поклялся обеспечить будущее Лиз. [1]

Битва за Нью-Йорк Уборка
«Иди сюда, эй, леди, давай.Послушайте, я купил грузовики для этой работы. Я привел совершенно новую команду. У этих парней есть семья. У меня есть семья. Я в этом замешан. Я могу потерять свой дом. «
» Мне очень жаль, сэр. Я ничего не могу сделать «.
— Адриан Тумс и Энн Мари Хоаг [src]

Toomes убирает битву за Нью-Йорк

В 2012 году, после битвы за Нью-Йорк, Bestman Salvage успешно заключил контракт на уборку города.Показав Финеасу Мэйсону фотографию битвы и вовлеченных в нее Мстителей, которую только что нарисовала его дочь, Тумс наблюдал за всеми своими людьми, убирающими Центральную станцию, и сказал Герману Шульцу использовать технологию Читаури, чтобы разобрать одну из разбившихся колесниц Читаури. поскольку их собственные инструменты на них не работали.

Toomes становится свидетелем прибытия Damage Control

Toomes противостоит Джексону Брайсу за то, что тот позже прибыл на свою работу, при этом Брайс обвиняет его опоздание в том, что его сигнализация не сработала, в то время как Toomes сказал ему сложить броню Читаури, как его просили сделать.Затем к Тумсу подошла Энн Мари Хоаг и ее команда агентов, сказав ему, что они поблагодарили его за его усилия, но что он должен был вывести свои команды из этого района, поскольку Управление разрушения обеспечило контракт на очистку после будущего Мстителей. сражения.

Тумс отчаянно просит Энн Мари Хоаг

Когда Тумс объяснил, что у него есть контракт на уборку Нью-Йорка, он пришел к выводу, что теперь им разрешено там находиться. Однако Хоаг был неумолим и велел команде Тумса прекратить всю свою работу и немедленно уйти.Отчаявшись сохранить работу, Тумс начал умолять Хога дать ему контракт, так как у него была собственная семья, которую нужно было поддерживать, и он уже вложил слишком много денег в эту работу, но Хоаг просто проигнорировал его просьбы и начал работать.

Тумс узнает, что Тони Старк виноват

Когда Фостер, один из людей Хога, насмешливо сказал Тумсу, что ему не следовало перегибать палку в своей работе, Тумс ударил его по лицу, заставив всех охранников вокруг Хога немедленно нарисовать свои оружие и приказ, чтобы Тоумс и его люди немедленно покинули этот район.Хоаг сказал Тумсу, что, если он захочет, он все еще может поговорить с Тони Старком о контрактах, если он хочет продолжить борьбу за работу, чтобы сохранить себя и всех своих людей занятыми. [1]

На пути к преступлению

Тумс видит отчет NY1 о контроле за повреждениями

«Вот что я вам скажу, давайте оставим это. Мир меняется. Пора и нам измениться».
— Эдриан Тумс — Рэнди Вейл [src]

Разъяренный разочарованием, Тумс смотрел репортаж NY1 о том, как Тони Старк создал Damage Control после битвы за Нью-Йорк, чтобы навести порядок в том беспорядке, который остался позади.Тумс смотрел отчет вместе с Германом Шульцем, который затем прокомментировал, как система теперь была настроена против них всех, причем Шульц отметил, что Мстителям платили за то, чтобы они убирали беспорядок, в то время как они остались безработными.

Тумс решает оставить у себя все оружие пришельцев

Просматривая эти отчеты, Рэнди Вейл обнаружил, что у группы все еще осталось большое количество технологий Читаури, которые не были возвращены Энн Мари Хоуг и ее собственной команде. хранится подальше, как было указано.Поскольку Джексон Брайс отказался перемещать его, Тумс решил сохранить его, убедив свою группу обратиться к преступной жизни, путем реверс-инжиниринга и использования этого инопланетного оружия для продажи на улицах, чтобы они могли зарабатывать деньги.

Toomes создает новый экзокостюм

В течение следующих четырех лет Toomes все еще работал вместе с Шульцем и Брайсом, нанимая Тинкерера для использования более продвинутых технологий и создавая свой собственный экзокостюм, избегая внимания ФБР, а также Мстители, поскольку они продолжали нарушать закон.Когда Стервятник прилетел на его базу, он с гордостью сказал Тинкереру и его команде, что бизнес идет хорошо, поскольку он предоставил им еще более передовые технологии, чтобы они могли использовать их в качестве оружия, а затем продавать их всем их новым покупателям. [1]

Торговля оружием

Роковая ошибка Джексона Брайса

Toomes продолжает создавать все новое оружие

«Я же говорил вам не стрелять в них на открытом воздухе!»
«Вы сказали, переместите товар».
«Под радаром.В зоне покрытия радара! Вот как мы выживаем ».
— Адриан Тумс и Джексон Брайс [src]

Спустя несколько месяцев бизнес Тумса по продаже оружия все еще процветал, в то время как сам Тумс все еще продолжал работать и работать в своей штаб-квартире, разрезая куски металла для создания нового оружия, готового к продаже прямо на черном рынке. . Однако вскоре ему позвонил Герман Шульц, что Человек-паук наткнулся на их сделку по оружию с Аароном Дэвисом и преследовал его по соседству, когда они пытались защитить себя.

Стервятник устраивает засаду и пытается убить Человека-паука

Тумс быстро надел костюм Стервятника и улетел к Шульцу, где они все еще пытались сбежать, и стреляли в Человека-паука из специально разработанного пистолета Читаури, вызывая хаос во всем улицы. Прибыв к мчащемуся фургону своей команды, Стервятник заметил Человека-паука, который собирался догнать их группу. Спрыгнув вниз, он схватил Человека-паука когтями, взлетев на сотни футов над Нью-Йорком, к полному ужасу Человека-паука.

Стервятник сбрасывает Человека-паука в озеро

Однако, когда Стервятник поднимал Человека-паука все выше и выше и дальше от грузовика, он приготовился убить линчевателя только для того, чтобы Костюм Человека-паука развернул парашют, вырывая юного героя из хватки Тумса. Видя, что его люди теперь успешно сбежали, Стервятник решил не продолжать преследование Человека-паука и вместо этого полетел обратно в свое логово, чтобы перегруппироваться с остальной частью его команды, оставив Человека-паука упасть в озеро в сотнях футов ниже. .

Тумс отклонил предложения Тинкерера

Стервятник в конце концов успешно приземлился обратно на свою базу, разъяренный тем, что он стал свидетелем, когда он снял свой собственный экзокостюм и ждал, пока его люди вернутся, яростно швыряя шлем через комнату. Пока Тоумс продолжал злиться, Тинкерер сообщил ему, что Дорис Тоумс пыталась связаться с ним, прежде чем отметить, что он закончил проектирование высоковакуумного уплотнения для Костюма Стервятника, но Туумс отверг этот дизайн, поскольку он все еще не хотел этого.

Тумс яростно спорит с Джексоном Брайсом

В конце концов, Шульцу и Джексону Брайсу удалось вернуться на базу, поскольку Брайс был в восторге от погони, игнорируя последствия своих действий. Тумс яростно противостоял Брайсу, спрашивая его, сколько раз он говорил Брайсу не стрелять из оружия, такого как Альтрон Бластер, публично, а Брайс защищал свои действия, говоря, что он должен продать оружие Аарону Дэвису, несмотря на то, что Тумс яростно напоминал ему, что он сказал ему убрать их из поля зрения.

Тумс, напоминающий Джексону Брайсу о рисках

Тумс отметил, что Брайс рискнул принести Контроль за повреждениями к их порогу, если они будут обнаружены, что даже может привести к тому, что Мстители узнают о них и разрушат все, что они построили. Затем Тумс начал издеваться над отношением Брайса и его недавними заявлениями о том, что он Шокер, из-за использования вооруженной перчатки, взятой из Кроссбоунса, которую Брайс просто проигнорировал, даже по-прежнему игнорируя Тумса, поскольку он отметил, насколько он полагался на эту операцию.

Тумс непреднамеренно убивает Джексона Брайса

В конце концов Тумсу надоело безрассудство и его отношение к Брайсу, и он сказал Брайсу, что теперь его уволили из своей организации. Разозленный потерей работы, Брайс пригрозил Тумсу, сказав, что он проинформирует власти об их операции. Затем Брайс спросил Тумса, что бы произошло, если бы он рассказал Дорис Тумс все о своем бизнесе. Это было слишком далеко для Тоумса, который тут же взял оружие и выстрелил из него в Брайса, мгновенно уничтожив его.

Тумс называет Германа Шульца «Шокером».

Смущенный и шокированный этими действиями, он спросил Тинкерера, взял ли он в руки антигравитационное ружье, но вместо этого взял ружье Читаури. Не обеспокоенный своим внезапным актом убийства своего бывшего друга и сослуживца, Тумс просто подошел к праху Брайса, поднял Шокер Gauntlet и затем передал его Шульцу, саркастически сказав ему, что теперь он стал Шокером. в то время как все остальные с ужасом наблюдали за насильственными действиями Тумса. [1]

Угон грузовика управления повреждениями

Стервятник начинает свое следующее скрытое ограбление оружия

«Я заметил конвой. Едущий позади камбуза».
«Развернуть якоря».
«Падение».
«Нет исходящих сигналов бедствия. Все в порядке».
―Vulture and Tinkerer [src]

Несколько дней спустя команда Тумса получила сообщение о том, что грузовик, полный конфискованной техники, направлялся в Хранилище Контроля за повреждениями через Мэриленд.В то время как Шокер и Тинкерер в фургоне неподалеку следили за исходящими сигналами бедствия, Стервятник украдкой перехватил грузовик. Прикрепив свои крылья к грузовику, Стервятник использовал Matter Phase Shifter, чтобы войти в грузовик.

Стервятник крадет грузовик с контролем повреждений.

Заметив прицел, когда он оказался внутри, не предупредив охранников, Стервятник начал наполнять вещмешок всеми обнаруженными им технологиями Читаури и Альтрона. К его удивлению, появился Человек-паук, из-за чего Стервятник быстро вышел из грузовика с технологией, которую он смог использовать.Прежде чем Стервятник смог уйти, Человек-паук использовал свои Веб-шутеры, чтобы вырвать у него свою спортивную сумку, прежде чем затем решил оскорбить Стервятника.

Стервятник снова сражается с Человеком-пауком

Решив убежать, прежде чем Человек-паук снова сможет нарушить свои планы, Стервятник восстановил экзокостюм и затем начал яростно лететь к Человеку-пауку, пытаясь разорвать спортивную сумку, но безуспешно. подальше от его рук. Увидев, что Человек-паук собирается отступить через созданную им червоточину, Стервятник закрыл Прерыватель фазы материи, запечатав Человека-паука в грузовике.Стервятник быстро сбежал, сердито оставив все свои украденные технологии.

Тумс видит новостной репортаж о Человеке-пауке

Вернувшись на базу, Тумс был в ярости из-за потери технологии. Тинкерер предложил модернизировать Костюм Стервятника, чтобы они могли совершить воздушное ограбление против Башни Мстителей, но Тумс отказал Мэйсону, спросив, достаточно ли у них средств для продажи Мак Гаргану, что Мейсон подтвердил. Тумс начал бормотать, что во всем виноват Человек-паук и он убьет его.Подслушивая, Герман Шульц показал Тумсу новостной репортаж о Человеке-пауке, спасающем дочь Тумса. [1]

Засада на пароме Статен-Айленд

Тумс и Герман Шульц идут на встречу

«Вы возитесь с вещами, которых не понимаете!»
―Сервятник — Человек-паук [src]

На следующий день Тумс и Герман Шульц пробрались на борт парома Статен-Айленд, где они планировали провести секретную встречу, чтобы продать больше своих технологий на основе Читаури и Альтрона преступникам.После того, как они обсудили свой план, Шульц оставил Тумса, пока он и Рэнди Вейл разбирались со своим последним покупателем, Маком Гарганом, в то время как Тумс остался и держался на расстоянии, готовый одеться и вмешаться, если во время их сделки что-то пойдет не так. с Гарганом.

Тумс встречается лицом к лицу с Человеком-пауком

Однако Шульц вскоре сообщил по радио Тумсу, что сделка была прервана Человеком-пауком. Услышав все это, Тоумс быстро побежал к своему фургону, где хранился его костюм, увидев, что Шокер был подавлен во время боя, а его собственная Рукавица застряла в перилах.Как только Тумс сбил одного из людей Гаргана, чтобы тот сел в фургон, он ненадолго встретился глазами с Человеком-пауком, прежде чем забраться внутрь фургона.

Тумс надевает свой экзокостюм и сражается.

Незадолго до того, как Человек-паук смог противостоять Тумсу, появилось ФБР, чтобы арестовать Гаргана и Шульца, отвлекая Человека-паука на достаточно долгое время, чтобы Тумс надевал свой костюм и вооружился пистолетом Читаури. Ворвавшись в двери фургона, Стервятник выстрелил в агентов и Человека-паука, которым удалось сбить агента ФБР с дороги, в то время как Стервятник случайно сбросил машину с парома, который столкнулся с Гарганом, и сбил его с пути.

Стервятник яростно сражается с Человеком-пауком

Освободив Шокера от его ремней, Стервятник сказал ему сойти с парома, поскольку они отступали от миссии. Не желая позволить Стервятнику сбежать, Человек-паук выстрелил в него из своих Веб-шутеров, однако Стервятник сопротивлялся, стреляя из оружия Читаури в Человека-паука, разрезая паутину своими крыльями. Во время боя Человек-паук получил преимущество, активировав паутину электрошокера, когда одной из нитей удалось поразить Стервятника в воздухе.

Стервятник сбегает с парома на Статен-Айленде

Удар паутины электрошокера заставил Стервятника уронить пистолет, который резко отреагировал на электричество, в результате чего он выстрелил несколькими лазерами, которые разрезали паром пополам, несмотря на отчаянные попытки Человека-паука. Интернет. Увидев его открытие, Стервятник взлетел на верх парома, где его ждал Шокер. С Шокером на борту своих крыльев Стервятник улетел из битвы, прежде чем Железный Человек смог появиться и помочь Человеку-пауку спасти пассажиров парома. [1]

Убедить команду

Тумс и Герман Шульц продолжают спорить

«Вот и все. Ты просто сбежишь?»
«Федералы ждали нас. Теперь мы на радаре Железного человека? Да, я бегу. Тебе тоже стоит».
«Ты же знаешь, что я не могу этого сделать».
―Vulture and Shocker [src]

После их фиаско на пароме Статен-Айленд, во время которого почти все они были обнаружены, а Мак Гарган был арестован ФБР, Тумсу сообщили, что Герман Шульц, наконец, решил выйти из команды и отправиться в бега, сославшись на что ФБР ждало своего часа, чтобы арестовать их, и поэтому риск был очень велик, приглашая Тоумса просто прийти и последовать за ним.

Тоумс решает провести еще одно финальное ограбление

Однако Тоумс отметил, что он не может просто уйти, так как его жена и дочь все еще полагаются на него. Стремясь убедить Шульца остаться, Тумс попросил Финеаса Мейсона создать высотное вакуумное уплотнение для костюма, готового к захвату грузового самолета Старка, чтобы украсть все технологии Stark Industries, и попросил Шульца остаться на один последнее ограбление, на которое он неохотно согласился, поскольку группа приступила к планированию миссии. [1]

Изучение личности Человека-паука

Тумс знакомится с Питером Паркером

«Держу пари, ты был рад, когда твой старый приятель Человек-паук появился в лифте, а?»
«Да, ну, я вообще-то не поднимался. Я видел все с земли. Очень повезло, что он был там в тот день».
«Старый добрый Человек-Паук».
— Адриан Тумс и Питер Паркер [src]

В ту же ночь, когда произошло ограбление, семья Тумс также подготовилась к предстоящему танцу возвращения на родину в Школе науки и технологий Мидтауна, поскольку Тумс лично тепло приветствовал Питера Паркера в своем доме, готового взять Лиз Тумс на танцы, и попытался устроить Светская беседа с неудобным мальчиком, который, казалось, бледнел от нервов перед возвращением на родину.

Тумс ведет светскую беседу с Питером Паркером.

Затем Тумс в шутку спросил, хочет ли Паркер каких-либо алкогольных напитков, отметив, что отказ был правильным ответом. Тумс наблюдал, как нервный Паркер неловко сделал несколько снимков с собственной дочерью Тумса, а Дорис Тумс спрашивала, правильно ли назвал Паркера ее муж. Затем Тумс объявил, что затем отвезет пару к танцам, заявив, что уезжает из города с Бестманом Утилизатором, пообещав, что это будет последняя работа.

Тумс заставляет подростков танцевать

Во время поездки на танцы Тумс спросил Паркера о его планах после окончания учебы. Лиз объяснила отцу, что Паркер проходила стажировку у Тони Старка. Интерес Тумса был вызван тем, что Лиз заявила, что Паркер даже дружила с Человеком-пауком. Когда Тумс спросил, на что похож Человек-паук, Паркер возился, побудив Тумса спросить, встречались ли они раньше, заявив, что голос Паркера был ему знаком, как будто он недавно где-то слышал его.

Тумс понимает, что Паркер — это Человек-паук

Однако Лиз продолжила рассказ о том, как Паркер пришел на их домашнюю вечеринку несколькими днями ранее, а через несколько минут ушел и таинственным образом исчез во время десятиборья. Понимая, что его неудачная сделка с оружием в Читаури состоялась в ту же ночь, что и вечеринка, Тумс начал подозревать, что Паркер мог быть Человеком-пауком, и спросил, как Паркер чувствовал себя спасенным у памятника Вашингтону, но Лиз заявила, что Паркер не был был с ними все в то время.

Тумс дает Питеру Паркеру только одно предупреждение.

По мере того, как подозрения Тумса относительно истинной личности Паркера подтвердились, он держал свои наблюдения тихими и незаметными. Как только Лиз вышла из машины по прибытии, Тумс сказал ей дать ему всего несколько минут наедине с Паркером, поскольку он хотел дать ему «отцовскую беседу». Как только она ушла, он вытащил пистолет из бардачка и столкнулся с Паркером, спросив его, осознает ли Лиз его двойственность, и предположив, исходя из всего молчания Паркера, что она не знала.

Тумс угрожает убить семью Питера Паркера

Пока Паркер внимательно слушал, Тумс объяснил, что щадит свою жизнь в благодарность за спасение жизни Лиз, находясь в Вашингтоне, округ Колумбия. Однако затем Тумс предупредил Паркера, чтобы тот прекратил преследовать его в его команде или еще что-то. он убьет его и всех, кого он любит, чтобы защитить свою семью. Затем Тумс побудил Паркера поблагодарить его за спасение его жизни, заявив, что теперь они равны, и отправили его на танцы и показали дочери, как хорошо провести время, прежде чем Тумс уехал. [1]

Противостояние Человека-паука

Тумс с нетерпением ждет Человека-паука

«Эти люди там, богатые и могущественные, они делают все, что хотят. Ребятам вроде нас, таких как вы и я, они не заботятся о нас. Мы строим их дороги, и мы ведем все их войны, и все такое, но они не заботятся о нас. Мы должны забрать их за ними. Мы должны съесть их остатки со стола. Вот как это бывает «.
―Сервятник — Человек-паук [src]

Опасаясь, что Питер Паркер не прислушается ко всем его предупреждениям, Тумс решил отправить Шокера в школу, чтобы перехватить его, если он попытается последовать за ним.Несмотря на предупреждения Тумса, Паркер отказался отступить и после боя с Шокером вскоре выследил Тумса до его убежища с помощью Неда Лидса и столкнулся с ним. Тумс пытался оправдать свои действия перед Человеком-пауком, объясняя, что все, что он делал, было поддержано своей семьей, и утверждал, что богатые и влиятельные люди ничего не заботят о таких простых людях, как они.

Тумс раскрывает свой секретный план Человеку-пауку

В попытке взять Тумса прямо под стражу, Человек-паук использовал свой веб-шутер, чтобы прижать его к столу.Однако Тумс продолжал утверждать, что Тони Старк заработал состояние на продаже оружия террористам, как и Тумс. Тумс также отметил, что он мог понять, почему Лиз Тумс понравился Паркер, отметив, что он не был впечатлен, когда впервые увидел его в дверном проеме своего дома, но заявил, что теперь он все понял.

Тумс оставляет Человека-паука задыхаться.

Когда Человек-паук все еще отказывался сдаваться, Тумс показал, что он на самом деле задержался, и вызвал свой экзокостюм, чтобы влететь в комнату.Когда Человек-паук хвастался, что экзокостюм не ударил его ни разу, Тумс заметил, что это не было его намерением. Затем Человек-паук слишком поздно осознал, что Тумс заставил костюм сломать опорные балки вокруг своего логова, заманив Человека-паука в ловушку под грудой обломков и оставив его задохнуться и в конечном итоге умереть там.

Тумс надевает свои улучшенные Крылья стервятника

Теперь, когда Паркер, похоже, раздавлен насмерть, когда его убежище развалилось вокруг него, Тумс вышел наружу, надев свои крылья стервятника, которые все были модернизированы Тинкерером.Глядя прямо на Нью-Йорк, Стервятник шпионил за Башней Старка и ждал, пока грузовой самолет, заполненный оружием Старк Индастриз и всеми остальными технологиями Читаури и Альтрона, не будет вывезен, чтобы он мог затем украсть их и продать все технологии на черном рынке. [1]

Угон грузового самолета Stark

Стервятник ждет сигнала, чтобы начать ограбление

«Я вижу самолет, но чувствую небольшое сопротивление.»
» Это наверное просто тормоз на новых турбинах. Остерегайтесь маскирующих камер. Оставайтесь в слепых зонах. «
» Развертывание высотного вакуумного уплотнения. Эта работа лучше «.
―Vulture and Tinkerer [src]

Казалось, что все угрозы его планам были устранены, Стервятник сидел над руинами своего штаба и ждал разрешения начать ограбление. Как только пришло время, Стервятник полетел за ним и быстро догнал грузовой самолет, покинувший Башню Старка с оборудованием, которое он планировал украсть.Беседуя с Тинкерером во время полета, Стервятник заметил, что Экзокостюм ощущался так, будто тащил за собой лишний вес.

Стервятник преследует самолет Тони Старка

Как только он догнал самолет, Стервятник сумел избежать того, чтобы его заметили маскирующие камеры, и прижался к борту самолета. Не вызвав никакой тревоги, Стервятник затем присоединился к самолету с помощью высотного вакуумного уплотнения, прежде чем он вошел внутрь с помощью фазовращателя Материи.Когда он вошел внутрь, Стервятник заметил Тинкереру, что это лучше сработает, поскольку Тинкерер затем напомнил ему, что каждая коробка в самолете стоит целое состояние.

Тумс успешно проникает в самолет Старка

Войдя в самолет, Тумс использовал антигравитационную пушку, чтобы проникнуть внутрь кабины, не обнаружив там никого, прежде чем он взломал их системы, чтобы преодолеть их безопасность с помощью Тинкерера, который был все еще наблюдая внизу, а также затем развертывая дрон-ловушку, чтобы сбить с толку наземный пульт управления самолетом, за которым Хэппи Хоган следил, во время их ограбления.Все шло по плану, Стервятник снял шлем и посмотрел на самолет.

Стервятник крадет оружие Stark Industries

Тумс обнаружил, что оно было заполнено даже большим, чем он мог надеяться, — ящиками с оружием Читаури, роботизированными частями Альтрона, а также различными доспехами Железного Легиона, все это будет стоить миллионы. на черном рынке. Когда Тумс посмотрел на некоторые технологии Stark Industries, которые включали коробки с дуговыми реакторами, которые использовались Тони Старком, он начал искать лучшую коллекцию технологий, которую можно было бы унести с собой. Затем Тумс начал просматривать все коробки. отбросив один из старых шлемов Железного человека, чтобы добраться до орудий Читаури, все они могли быть сняты с оценки мастером и проданы, чтобы получить значительную прибыль.

Тумс понимает, что Человек-паук теперь вернулся.

Все еще восхищаясь оборудованием Мстителей, Стервятник обнаружил, что высотное вакуумное уплотнение смещено, в результате чего из самолета высасывается воздух и срабатывает сигнализация. Поднявшись к камерам видеонаблюдения, Тумс обнаружил, что Человек-паук пережил их предыдущую встречу, вырвался из-под завалов, тихо последовал за ним и теперь пытается сбить свой экзокостюм с самолета, в результате чего Тумс в отчаянии выругался.

Стервятник бросается в бой с Человеком-пауком

Разгневанный тем, что все его планы снова были прерваны, Тумс быстро надел свой экзокостюм и сражался с Человеком-пауком вне самолета, используя когти на своем костюме, чтобы попытаться сбить Паука. -Человек с самолета. Стервятник попытался быстро сбить Человека-паука, только чтобы он использовал свои Веб-шутеры, чтобы приставать к Стервятнику, прежде чем они оба были почти брошены внутрь двигателя самолета, в результате чего крылья Стервятника получили тяжелые повреждения.

Стервятник яростно пытается убить Человека-паука

Быстро летя обратно в битву, Стервятник попытался убить Человека-паука, когда он использовал свои крылья, чтобы нанести удар по паутине, в результате чего искры и осколки самолета были разбросаны вокруг него. уничтожил один из двигателей, что привело к потере управления самолетом. Видя, что происходит, когда самолет падает с неба, Тинкерер умолял Стервятника отказаться от миссии, пока они еще могли, но Тумс отказался уйти, не имея хотя бы одного ящика, чтобы заработать состояние.

Стервятник пытается украсть хотя бы один ящик

Пока Человек-паук сосредоточился на попытке использовать свои веб-шутеры, чтобы перенаправить корабль из Нью-Йорка, Стервятник разрезал внешнюю оболочку самолета своими крыльями, чтобы попытаться поднять ящик. Наполненный дуговыми реакторами, но прежде чем Стервятник смог схватить ящик, самолет совершил аварийную посадку на пляже Кони-Айленда, в результате чего они оба сильно ударились о землю. Оба выжили в аварии, но Крылья Стервятника были сильно повреждены в результате аварийной посадки. [1]

Дуэль на Кони-Айленде

Стервятник готовится атаковать Человека-паука

«Пора домой, Пит».
«Я пытаюсь тебя спасти!»
―Гриф и Человек-паук [src]

Когда Человек-паук медленно пришел в сознание после ужасающей аварийной посадки, он снял маску и оглядел обломки разрушенного грузового самолета Старка. Поскольку в результате аварии у него в ушах начал громко звенеть, Стервятник использовал это в своих интересах и смог наброситься на Человека-паука, который был застигнут врасплох, вылетев из дыма вокруг Кони-Айленда и сбив Человека-паука с ног. с силой.

Стервятник яростно подчиняет Человека-паука

Несмотря на повреждение его костюма-крыла, Стервятник саркастически приветствует Человека-паука, летит по пляжу и врезался в Человека-паука, который был слишком дезориентирован после крушения, чтобы должным образом защищаться. сам, позволив Стервятнику прижать его когтями к земле и несколько раз бить по лицу, прежде чем подлететь в воздух и бросить на землю. Уже подавив его, Стервятник схватил Человека-паука своими когтями и ударил его по земле еще несколько раз.

Стервятник решает пощадить Человека-паука

У пары произошел короткий конфликт в воздухе, который Стервятник быстро выиграл, когда Человека-паука повалили на землю. Покорив своего врага, Стервятник приготовился казнить Человека-паука, но отвлекся, когда заметил ящик, полный дуговых реакторов. Чувствуя, что ограбление еще не было полным провалом, Стервятник бросил Человека-паука, подошел к горящему самолету и схватил один из этих ящиков своей парой когтей, пытаясь сбежать и продать всю технологию Stark Industries на черном рынке за огромная прибыль.

Стервятник пытается украсть все дуговые реакторы

Однако вся радиация, испускаемая дуговыми реакторами, вызвала короткое замыкание технологии Читаури в его экзокостюме и вызвала неисправность его крыльев. Видя новую опасность, как он был свидетелем того, что произошло в Вашингтоне, округ Колумбия, Человек-паук попытался оттащить Стервятника от дуговых реакторов до того, как костюм взорвался, но он был слишком поздно и проигнорировал его мольбы спасти его, охваченный жадностью, когда он затем отчаянно пытался сбежать.

Тумс подчинен и взят под стражу

Игнорируя попытки Человека-паука помочь ему, костюм Стервятника в конце концов загорелся. Сразу после того, как Стервятник приземлился, Человек-паук столкнулся со всеми обломками и вытащил его живым. Бессильный без костюма и слабый от взрыва, Человек-паук смог использовать свои веб-шутеры, чтобы привязать Стервятника к ящику, где он был позже найден и арестован Хэппи Хоганом и ФБР, при этом Стервятник не оказал никакого сопротивления, поскольку он был взят под стражу. [1]

В заключении с Mac Gargan

Мак Гарган встречает Тумса в тюрьме

«Я слышал слух … ты знаешь, кто он».
«Если бы я знал, кем он был, он был бы уже мертв».
―Мак Гарган и Адриан Тумс [src]

После дуэли на Кони-Айленде Тумс был отправлен в тюрьму в ожидании суда. Не желая, чтобы Лиз и Дорис Тумс наблюдали за этим, он попросил их переехать из Нью-Йорка.В тюрьме Тумс встретил бывшего потенциального покупателя Мака Гаргана, который был сильно травмирован после засады на пароме Статен-Айленд, в которой Стервятник случайно бросил в него машину и сбил его в реку, где он был затем арестован.

Тумс отрицает, что знает имя Человека-паука.

Гарган, однако, настаивает на том, что он по-прежнему не винит Тумса в своих травмах, а вместо этого обвиняет Человека-паука. Когда Тумс слушал, Гарган заметил, что у него были друзья со стороны, желающие убить Человека-паука, и отметил, что до него дошли слухи о том, что Тумс знал, кто такой Человек-паук.Полагая, что он все еще должен Питеру Паркеру, Тумс просто ответил Гаргану, что если бы он знал, кто такой Человек-паук, он уже был бы мертв, прежде чем уйти, чтобы поговорить со своей семьей. [2]

Личность

«Нет ничего важнее семьи. Вы спасли жизнь моей дочери, и я никогда не смогу забыть что-то подобное, поэтому я дам вам один шанс. Вы готовы? Вы проходите через эти двери и забываете обо всем этом. И никогда, никогда больше не вмешивайся в мои дела, потому что если ты это сделаешь, я убью тебя и всех, кого ты любишь.Я убью тебя мертвым. Вот что я сделаю, чтобы защитить свою семью ».
―Сервятник — Человек-паук [src]

До того, как Damage Control выгнал Тумса из бизнеса, он, по всей видимости, был трудолюбивым человеком, честно поддерживавшим свою семью. Однако после того, как его выбросили из бизнеса, он пришел в отчаяние, зная, что он и его семья будут страдать, показывая, что он глубоко заботился об их благополучии. В результате он стал безжалостным и расчетливым человеком, который был готов совершать преступления, чтобы сделать все возможное, чтобы поддержать свою семью.Вне своей новой криминальной карьеры Тоумс продолжает оставаться обычным семьянином.

Несмотря на свою криминальную карьеру, Тумс старается не вовлекать свою семью в какие-либо его дела на черном рынке, и он не хочет, чтобы они узнали об этом, оставаясь вне поля зрения Мстителей в течение многих лет. Несмотря на свою сильную ненависть к Тони Старку, Тумс также не стремится активно отомстить ему, потому что это привлечет внимание к его действиям. Он был полностью готов бросить свою криминальную карьеру, если его семья будет близка к тому, чтобы узнать об этом или если его операции будут раскрыты.После ареста Тумс попросил свою жену и дочь переехать в другой город, чтобы им также не пришлось видеть его суд и заключение в тюрьму.

Первоначально Тумс был раздражен Человеком-пауком и несколько раз пытался увести молодого героя с его пути, его реалистичное мировоззрение противоречило безграничному идеализму Человека-паука. Тем не менее он был впечатлен целеустремленностью и отчасти упорством героя. Однако после того, как его дочь была спасена Человеком-пауком и узнав, что он на самом деле Питер Паркер, свидание Лиз, он постепенно развил чувство уважения к нему и даже попытался убедить его присоединиться к его стороне.Однако, когда Тумс и Паркер были одни в его машине, он предложил Паркеру положить конец их вражде мирным путем, если Человек-паук согласится больше не вмешиваться в его планы; он все еще был готов убить его, если он продолжит бороться с ним.

Тумс оказался по-прежнему благородным человеком, поскольку после того, как Человек-паук разрушил его операции и посадил его в тюрьму, он выразил некоторую степень благодарности Паркеру за спасение его жизни и жизни своей дочери, притворившись, что он не догадался о Пауке- Тайная личность человека пока не выяснена, когда об этом спросил Мак Гарган.

Силы и способности

Возможности экзокостюма стервятника

Стервятник с его крылатой техникой

Тумс был оснащен летающим механическим костюмом, созданным Финеасом Мейсоном с использованием спасенных технологий Читаури. Как Стервятник, он будет использовать костюм для ограблений другого оборудования, добытого из Damage Control. По внешнему виду он представляет собой металлический бронежилет, снабженный крылатой стальной обвязкой.

  • Сверхчеловеческая сила : Экзокостюм дает Стервятнику силу, чтобы одолеть как людей, так и сверхлюдей, в то время как крылья и когти достаточно сильны, чтобы с легкостью разрушать бетон и поднимать тяжелые предметы.
  • Сверхчеловеческая прочность : Костюм Стервятника снабжен металлической броней и разработан, чтобы выдерживать удары сверхлюдей, таких как Человек-паук.
  • Сверхчеловеческая маневренность : Системы реактивного движения костюмов позволяют Vulture летать и маневрировать в воздухе с невероятной маневренностью и координацией, несмотря на его большой и громоздкий корпус.
  • Рейс : Костюм Стервятника оснащен мощной крылатой подвеской, которая также имеет реактивные двигательные установки, которые позволяют ему летать на высоких скоростях и легко парить в небе.Экзокостюм Стервятника действует аналогично костюму Сокола.

Способности

  • Одаренный интеллект : Тумс очень умен, он способен определить секретную личность Человека-паука на основе существующей информации. Он может видеть прибыль во всем, поскольку видит, что технологию Читаури можно использовать для более гнусных нужд.
  • Опытный тактик : Тумс смог спланировать и провести атаку на грузовик для контроля повреждений и захват грузового самолета Старка.Ему даже удавалось оставаться вне поля зрения Мстителей в течение многих лет, пока его не поймал Человек-паук.
  • Combatant : Toomes опытен в бою до такой степени, что он смог многократно превзойти улучшенного Человека-паука во время их столкновения.
  • Опытный стрелок : Тумс смог прицелиться и выстрелить из ружья Читаури с достаточной точностью, чтобы пробить паутину, удерживающую Германа Шульца с большого расстояния.

Оборудование

Оружие

Стервятник надевает Экзокостюм во время полета

  • Экзокостюм Стервятника : Созданный Финеасом Мэйсоном, Стервятник использует костюм, сделанный по технологии Читаури и оснащенный металлической бронежилетом, оснащенный парой когтей и крылатым, съемная стальная обвязка, позволяющая ему летать.Крылья состоят из сдвоенных острых лезвий, которые способны разрушать целые бетонные столбы, а также могут складываться и разрезать предметы подобно ножницам. Вторая версия крыльев Vulture имеет дрон-ловушку, хранящийся в заднем отсеке, и дополнительную функцию, которая дает ему возможность формировать высотное вакуумное уплотнение, сближая крылья.
  • Посох Читаури : стандартное оружие войск Читаури, вторгшихся на Землю во время битвы за Нью-Йорк.Тоумс использовал Посох Читаури, чтобы отключить источник энергии Колесницы Читаури.

Стервятник крадет запас орудий Читаури

  • Оружие Читаури : стандартное оружие войск Читаури, вторгшихся на Землю во время битвы за Нью-Йорк. Стервятник использует свою мощную лучевую пушку, чтобы стрелять по Джексону Брайсу, что разрушило его здоровье и способно разделить переправу на Статен-Айленд пополам.
  • Matter Phase Shifter : Стервятник использовал технологию, разработанную мастером, чтобы сделать часть поверхности неосязаемой и прозрачной, сделав ее похожей на стекло с пурпурным свечением.Он особенно прикрепил это устройство к грузовикам с контролем повреждений и даже к корпусу грузового самолета Мстителей, чтобы пройти через них и украсть припасы внутри.
  • SIG Sauer P229 : У Тумса был один из этих пистолетов, и он хранил его в своей машине. Он использовал это, чтобы угрожать Питеру Паркеру, когда тот привел его и его дочь на их танец возвращения на родину, правильно угадав личность Паркера как Человека-паука и предупредив его держаться подальше от своего бизнеса.

Прочее оборудование

  • Arc Reactors : Тумс попытался украсть несколько Arc реакторов с грузового самолета Старка, но его планы были прерваны Человеком-пауком.Он попытался украсть ящик, полный их, но самолет разбился из-за его битвы с Человеком-пауком, сорвавшей его планы. Экзокостюм Тумса вышел из строя из-за излучения дуговых реакторов, которое позволило Человеку-пауку подчинить его.
  • Switchblade : Тумс использовал этот нож, чтобы освободить свою руку от паутины Человека-паука во время их противостояния в его убежище.

Объекты

Тумс возвращается в свою штаб-квартиру

  • Штаб-квартира Адриана Тумса : Тумс владел большим складом во время работы в Bestman Salvage, однако, когда его компания была захвачена Damage Control, Тумс затем превратил склад в свою базу для его преступной карьеры, в нем размещалось все его незаконно произведенное оборудование, в то время как Тинкерер переделывал его.Однако Тумс был вынужден уничтожить объект, когда он был обнаружен Человеком-пауком, используя свой экзокостюм, чтобы разрушить опорные балки и раздавить Человека-паука.
  • Toomes Residence : Используя деньги, которые он заработал за свою преступную жизнь в качестве Стервятника, Toomes и его семья переехали в более крупный и более дорогой дом. Живя в доме, Тумс приветствовал свидание Лиз Тумс на «Возвращении домой», Питера Паркера, прежде чем предложить отвезти их обоих на танцы.

Тюрьмы

Добавляются

Отношения

Общая информация

  • В комиксах Стервятник изначально летал с парой магнитных крыльев, чтобы отомстить своему бывшему партнеру по бизнесу Грегори Бестману.Он также был одним из основателей повторяющейся группы врагов Человека-паука, Зловещей шестерки, наряду с Мистерио и Электро.
  • В комиксах Уилсон Аллан — отец Лиз Аллан и второй муж Дорис Рэкстон. Однако это не первый раз, когда отец Лиз становится суперзлодеем. В Ultimate Comics ее отец — злодей-мутант Блоб.
  • Воротник куртки-авиатора Тумса — намек на многие костюмы Стервятника в комиксах.
  • Стервятник — третий персонаж супергеройского типа, основанный на летающем животном, которого изобразил Майкл Китон, с двумя предыдущими — Бэтменом в Бэтмен и Бэтмен возвращается и Бердменом в Birdman или (Неожиданная добродетель невежества) .
  • Тумсу очень не нравится Тони Старк за то, что он уволил его из бизнеса. Персонаж Майкла Китона в фильме Birdman или (Неожиданная добродетель невежества) , Ригган Томпсон, испытывает аналогичную неприязнь к Роберту Дауни-младшему из-за того, что, хотя они оба добились известности, изображая супергероев, Дауни — одна из самых больших звезд в кино. Голливуд, пока он ушел в безвестность.

За кадром

Список литературы

Внешние ссылки

В мире COVID-19 владельцам отелей следует опасаться фондов-стервятников

Первые десять месяцев года поставили владельцев отелей, операторов и инвесторов перед рядом беспрецедентных проблем.Деловая среда, окружающая индустрию гостеприимства в 2020 году, быстро меняется, разрушается и меняется. Пандемия COVID-19 и другие недавние заголовки показали нам всем, что городские районы и их основные центры гостеприимства должны адаптироваться к новому рынку, которого никто из нас не мог предвидеть. Однако для опытного владельца или инвестора в сфере гостеприимства такие периоды больших перемен могут предоставить столь же большие возможности.

В мире COVID-19 не все отели будут одинаковыми.По мере того, как пандемия стихает, отели с курортным характером и заметными элементами для активного отдыха или оздоровления, а также объекты гостеприимства, которые могут быстро адаптироваться к подобным впечатлениям, лучше расположены, чтобы воспользоваться туристическим всплеском, которое ожидается после возобновления работы в стране. .

С началом зимних месяцев следует ожидать, что приличный процент семей будет следовать своей ежегодной традиции и брать зимние каникулы. Основываясь на отзывах, которые мы получаем от наших клиентов, мы ожидаем, что путешественники сосредоточат внимание на мероприятиях на свежем воздухе, таких как национальные парки или пляжи.После нескольких месяцев соблюдения директив о хранении дома и поощрения к социальному дистанцированию американские путешественники минимизируют свое потенциальное воздействие на здоровье, выбирая объекты для отдыха на открытом воздухе, которые также обеспечивают конфиденциальность. В отелях, расположенных вдоль основных маршрутов или транспортных магистралей или рядом с ними, также должен наблюдаться всплеск активности, поскольку мы ожидаем, что в зимние месяцы семьи будут устраивать поездки на автомобиле.

Иная картина для отелей в концентрированных городских районах, которые считались очагами пандемии.Традиционным отелям типа «большой ящик», расположенным в традиционных центральных районах города, особенно в городах, признанных очагами пандемии, будет сложнее всего вернуться к нормальному уровню заполняемости. Дизайн и расположение этих отелей, а также их типичная зависимость от проведения специальных мероприятий с большим количеством посетителей, таких как бизнес-конференции, потребуют от владельцев подумать о том, чтобы сэкономить любой капитал, который они могут иметь в своей собственности, путем передачи собственности со скидкой.

Поскольку все больше и больше исследований показывают, что в этом году возможности для отдыха на открытом воздухе будут актуальны, руководители городских отелей должны принять во внимание эту тенденцию и попытаться максимально адаптировать свои свойства.Операторы отелей с некоторыми удобствами на открытом воздухе могут еще раз подчеркнуть эти аспекты своей собственности, особенно если они еще не воспользовались ими до пандемии. Эти помещения можно переоборудовать или отремонтировать, чтобы они играли большую роль в программе отеля. Кроме того, эти отели могут добавить к своим объектам оздоровительный центр. Хотя внести такие важные изменения в операционную деятельность будет сложно для любого бизнеса, для городских отелей это может оказаться спасительным решением.

Однако некоторые владельцы отелей и инвесторы решат, что операционных подходов к рецессии COVID-19 недостаточно, и что сейчас самое время продавать. Эти решения, конечно, зависят от инвестора и его или ее инвестиционной стратегии. Распоряжение отелями также будет мотивировано необходимостью избежать (или урегулировать) дефолт в отношении их долгового финансирования. В зависимости от местоположения и характера их деятельности, владельцы отелей будут вынуждены соблюдать коэффициент покрытия обслуживания долга или условие DSCR, которое обычно включается в их кредитные соглашения.Поскольку денежные потоки многих отелей достигли исторического минимума, выполнение условий DSCR для некоторых владельцев отелей будет становиться все труднее и труднее. В результате мы ожидаем увидеть рост продаж гостиничной недвижимости и капитала такой недвижимости в ближайшие месяцы. Для инвесторов, стремящихся к выходу из своих обязательств перед своими ипотечными кредиторами, своевременная реализация контрольной или миноритарной доли в их гостиничной собственности может быть их единственным шансом на возвращение части своего капитала. Однако вопрос о том, облегчат ли эти потенциальные покупатели их жизнь, совсем другой вопрос.

В последние месяцы к нам неоднократно обращались инвесторы и клиенты «белого рыцаря», формирующие фонды возможностей, которые стремятся воспользоваться или спасти проблемные отели и / или связанные с ними долги. Владельцы отелей должны опасаться того, что несколько инвесторов из числа «белых рыцарей» на самом деле являются замаскированными фондами-стервятниками. Вообще говоря, термин «фонд-стервятник» обычно относится к хедж-фонду, фонду прямых инвестиций или фонду проблемных долгов, который сознательно ищет и покупает доли в акционерном капитале и / или долговые ценные бумаги в проблемных инвестициях, принимая при этом то, что можно было бы считать агрессивным подходом. с рассматриваемой проблемой.Они прямо контрастируют с настоящими «белыми рыцарями» или инвесторами, которые вместо этого стремятся сотрудничать с управленческими командами предприятий или активов, в которые они инвестируют. Если оставить в стороне достоинства этих двух подходов, средний инвестор в недвижимость определенно предпочел бы иметь дело со вторым, а не первым. Но когда они сталкиваются с привлекательным, но, казалось бы, неожиданным предложением или списком условий на вечеринке-сюрпризе, как инвесторы могут узнать, имеют ли они дело со стервятником или белым рыцарем?

К счастью, оба этих подхода имеют идентифицируемые черты и характеристики.В первую очередь, бренд и репутация потенциального инвестора многое расскажут. Хорошо зарекомендовавшие себя фонды-стервятники будут иметь соответствующую репутацию в отношении того, как они подходят к бизнесу, в который они инвестируют. Когда вы сталкиваетесь с новым партнерством или возможностью кредитования, разговор с другими профессионалами в области недвижимости и инвесторами о рассматриваемом контрагенте, вероятно, является лучшим способом получить «известность на улице». Белые рыцари и фонды стервятников также имеют тенденцию придерживаться различных секторов и подсекторов индустрии недвижимости.Фонды-стервятники с большей вероятностью будут кредитными фондами (или даже гибридными фондами, сочетающими инвестиции в акционерный капитал и долговые обязательства). Они также с большей вероятностью будут выполнять функции распорядителей капитала, в то время как белые рыцари, как правило, будут местными операторами. Термин «фонды-стервятники» обычно используется для характеристики инвесторов в области прямых инвестиций и хедж-фондов и, например, редко используется в отношении страховых компаний, занимающихся инвестициями в недвижимость. С точки зрения переговоров, у фондов-стервятников даже другой набор приоритетов, чем у белых рыцарей.Они с большей вероятностью будут настаивать на строгих финансовых и операционных соглашениях, чтобы держать своих партнеров или заемщиков на очень и очень коротких поводках на протяжении всего периода отношений. Что касается кредитных операций, фонды-стервятники также с гораздо большей вероятностью будут бороться за обременительные премии за предоплату во время переговоров.

Владельцы отелей и инвесторы сталкиваются с ситуацией, когда в этом году кардинально изменился бизнес-ландшафт. Они сталкиваются с проблемами, связанными как с операциями, так и с капиталом.Любой владелец, рассматривающий возможность привлечения новых инвесторов, кредиторов или партнеров, должен учитывать характер предполагаемых деловых отношений, о которых идет речь, и то, как на них повлияла пандемия и другие недавние события. Что не изменилось для профессионалов индустрии гостеприимства, так это важность понимания новой среды, в которой мы находимся, и того, как это можно использовать в своих интересах.

Луис Флорес — управляющий партнер офиса Saul Ewing Arnstein & Lehr в Майами.Он представляет интересы девелоперов на национальном уровне при приобретении, строительстве, девелопменте, аренде, рефинансировании и продаже пустующих земель, проектов кондоминиумов, многоквартирных жилых комплексов, гостиниц, коммерческих торговых центров и коммерческих офисных зданий. Луис также специализируется на банковском деле и кредитовании, представляя национальные и местные финансовые учреждения в коммерческих ипотечных и мезонинных кредитных сделках с недвижимостью по всей территории Соединенных Штатов.

Тео Виктория — сотрудник офиса Сола Юинга Арнштейна и Лера в Майами.Он специализируется на вопросах недвижимости, включая контракты на продажу, закрытие, аренду, комплексную проверку и проверку прав собственности.

Вот почему Стервятник стал героем Человека-паука: Возвращение домой | автор: Кевин Фролейкс

Вчера вечером я смотрел последний фильм по франшизе «Мстители», Человек-паук: Возвращение домой , который представляет собой новую улучшенную перезагрузку одного из самых любимых героев Marvel. Этот герой, конечно же, Человек-паук. Это может показаться очевидным, но я считаю необходимым напомнить себе, что это был фильм о Человеке-пауке, потому что, дойдя до конца фильма, я понял, что персонаж Майкла Китона, Адриан Тумс (он же Стервятник), был настоящим главным героем. .

(ПРЕДУПРЕЖДЕНИЕ: ЕСЛИ ВЫ НЕ УВИДИЛИ ЧЕЛОВЕКА-ПАУКА: ИДЕТЕ, НЕ ЧИТАЙТЕ! СПОЙЛЕРЫ ИДУТ! ВАС ПРЕДУПРЕЖДАЛИ!)

Хорошо, так почему я болел за «плохого парня» из этой истории? Прежде всего, мы не имеем дело с каким-то сумасшедшим маньяком с манией величия. Адриан Тумс — не какой-то анархист, создающий хаос просто так. Он скромный рабочий, который зарабатывает на жизнь строительством Нью-Йорка после того, как Мстители все разрушили своей безрассудной бдительностью.

В начале фильма мы видим, как Тумс выступает в роли мастера для группы рабочих, которых он нанял, чтобы помочь выполнить работы по очистке и восстановлению. Это большая работа, но это также означает работу для него и его команды, а это значит, что они будут получать зарплату, а еда будет на их столах по ночам.

Затем приходит правительственная бригада уборщиков и сообщает Тумсу и его команде, что они возьмут верх. Все расходы, которые Тоумс вложил в оборудование, — это его проблема, а не их.Чтобы добавить оскорбления к травме, Тоумс и его команда узнают, что правительственная бригада по уборке связана не кем иным, как с Тони Старком, также известным как Ironman. Знаешь, миллиардер Мститель с бомбоубежищем, который может взорвать все одним нажатием кнопки. Тоумс сам говорит, что тем же парням, которые нанесли ущерб, теперь платят за то, чтобы они его убрали. Для меня это звучит как жульничество.

Перенесемся на 8 лет вперед. Тумс и его команда немного изменили свою бизнес-модель. Используя некоторые инопланетные технологии, добытые на стройплощадке, они создали предприятие по производству и распространению оружия.Это первое знакомство с Адрианом Тумсом в роли Стервятника, крутого владельца малого бизнеса, который начал с самых низов и добился своего собственного потрясающего костюма Железного человека, но с крыльями. Честно говоря, когда я впервые увидел новый костюм Vulture, я подумал: «Правда? Он просто еще один Железный Человек. Но знаете что, может быть, это американская мечта вселенной Marvel. Вместо белого штакетника и двора, может быть, мечтаете обзавестись собственным костюмом Железного человека. Это может показаться безумным, но это далеко не самая странная идея, связанная с фильмом о мальчике-пауке.

Стервятник должен быть злодеем истории, но почему? Потому что он не Человек-паук, вот почему. Джокер явно был злодеем Темный рыцарь не только потому, что он не был титульным «Темным рыцарем», но и потому, что он был убийцей-психопатом. Он загрузил лодку, полную гражданских, взрывчаткой, чтобы поиграть в какую-то странную интеллектуальную игру с Бэтменом, просто чтобы доказать свою точку зрения. Какие?! Стервятник даже близко не касается такого уровня подлости. Фактически, единственный человек, которого он убивает в фильме, — это оригинальный чувак, который называл себя «Шокером».Этот парень был безрассудным придурком, который слишком хотел навести оружие на симпатичного молодого человека, который просто пытается купить ружье под мостом. Кроме того, стоит отметить, что Тумс не хотел убивать Shocker v1, он думал, что использовал нелетальное антигравитационное ружье или что-то в этом роде. Ну ладно, большой потери нет. Этот парень был придурком. Shocker v2 кажется классным парнем, с которым я мог бы выпить пива после работы. Иногда быть менеджером означает принимать трудные решения, например, кого нанять, а кого испарить.

Хорошо, вот в чем дело о Стервятнике.Он торговец оружием, и его продукция вредит людям, но что привело его к этой жизни? Он был счастлив заниматься строительством и уборкой своего города, пока какой-то бабник-миллиардер не вошел и не забрал у него работу. И не просто бабник-миллиардер, а Тони Старк, бабник-миллиардер, который любит себя так сильно, что никогда не уклоняется от фотоаппарата. Так что теперь Стервятник должен каждый день видеть лицо этого парня по телевизору, будучи богатым и щупающим цыплят. Я уверен, что это неправильно расскажет Тумсу, поскольку 1) он парень из рабочего класса и 2) у него есть жена и дочь, о которых нужно думать.Фактически, вся его мотивация стать Стервятником заключалась в том, чтобы обеспечить свою жену и дочь, а не в каком-то безумном желании мести. Он пытается победить, играя по правилам, которые общество уже приняло как нормальные. Костюм Железного человека Тони Старка намного мощнее, чем костюм Стервятника. Нужны доказательства? Костюм Стервятника — это, по сути, прославленный воздушный змей, тогда как костюм Железного человека оставляет после себя столько разрушений, что фактически создает рабочие места. Кроме того, давайте не будем забывать, что существует множество производителей оружия, продающих оружие каждый день.Забудьте об оружии, производители сигарет наносят по всему миру больше вреда, чем оружие Стервятника. Он предоставляет продукт и услугу в обмен на возможность обеспечить безопасность своей семье. Он подарил своей жене красивый дом, а дочери возможность посещать очень хорошую среднюю школу, которая направит ее на путь успеха на всю оставшуюся жизнь. Это американская мечта, прямо за обладание собственным костюмом Железного человека. Но с крыльями.

Хорошо, теперь давайте поговорим о Питере Паркере, также известном как Человек-паук, плаксивом маленьком хулигане, который думает, что заслуживает мира на серебряном блюде.О, я умный, поэтому могу просто поспать в классе, бла-бла-бла, я украл щит Капитана Америки, чтобы стать Мстителем, ныть, скулить, скулить. Это бесконечная симфония «я, я, я» с этим ребенком, и знаете, что самое худшее? В итоге он получает именно то, что хочет! Ты серьезно?! Его высокомерие приводит к тому, что он бессознательно кладет бомбу в рюкзак своего друга и чуть не убивает лифт, полный детей и Мартина Старра! Затем, в конце фильма, Тони Старк предлагает сделать из него новейшего Мстителя.Конечно, он отказывается, но Тони Старк не знал, что он это сделает. У него были представители прессы, готовые получить сенсацию (опять же, Тони Старк — медиа-шлюха)!

Кроме того, говоря о Мстителях, Тони Старк награждает Питера Паркера высокотехнологичным костюмом паука, который, как вы уже догадались, является еще одним чертовым костюмом Железного человека. Голос говорящего робота, миллионы гаджетов, работа! Сколько, черт возьми, Iron Men нам нужно в этом фильме? Одного Железного Человека — много! Black Sabbath знали об этом, когда Оззи пел «Я Железный Человек».Он не пел: «Эй, мы — кучка Железных людей, которые делают что-то в наших сверхмощных костюмах, которые делают всю работу за нас». Удачи тебе сыграть рифф на это, Тони Айомми.

В любом случае, я хочу сказать, что этот ребенок ничего не хочет и не сочувствует окружающим. Я имею в виду, что его дядя только что умер, и это едва заметно на его социопатическом радаре подросткового возраста. Все, что он знает, это то, что он понравился бабнику-миллиардеру, подарил ему модный костюм Железного Паука и в конце концов был вознагражден постоянной работой в Мстителях, несмотря на то, что он еще даже не закончил среднюю школу.Тем временем у нас есть Адриан Тумс, который упорно трудится, чтобы построить жизнь для него и его семьи. Питер Паркер получил свой костюм в качестве подачки от богатого парня в постели с правительством, Тумс добился своего благодаря собственной изобретательности и созданию команды людей, которые могли воплотить в жизнь его мечту стать Железным Человеком, но с крыльями.

На протяжении всего фильма Человек-паук и Железный человек доказывают, что они злодеи, а не Стервятник. Идиотское поведение Человека-паука разрушает местный гастроном, принадлежащий доброму человеку из рабочего класса, который пытается научить Питера Паркера важности образования.Он также подвергает опасности всех в или около Монумента Вашингтона, закладывая бомбу в рюкзак Неда, уничтожает двигатель самолета, который, скорее всего, упал над густонаселенной частью Нью-Йорка, и он почти убивает лодку, полную людей, пытающихся увидеть Статую Свобода бесплатно, воспользовавшись паромом на Статен-Айленд (краткое PSA: не платите за прогулку на лодке, просто сядьте на паром и посмотрите статую бесплатно). Ой, погоди секундочку, уничтожить лодку, полную невинных людей? Похоже на персонажа из The Dark Knight , который не является героем!

Стервятник, с другой стороны, заботится о своем народе.Люди, с которыми он работает, люди, с которыми он ведет бизнес, его жена и дочь. Способы, с помощью которых он решил обеспечивать этих людей, конечно, сомнительны, но, в конце концов, он делает это за них. Во-первых, он семьянин, а во-вторых, человек-стервятник. Когда его наконец поймали и судили за его «преступления» (что, будем честными, его единственное настоящее преступление заключалось в подрыве финансируемого правительством бизнеса по разработке оружия. ПРОБУДИТЕ ЛЮДЕЙ!), Его главной заботой было вывести свою семью из города, чтобы они не пришлось бы видеть его таким.

Вдобавок к этому у Стервятника было два шанса убить Человека-паука, но он решил этого не делать. У него был этот слабак в машине, и вместо того, чтобы убить его прямо здесь, он сказал ему зайти внутрь и показать дочери, как хорошо он проводит время на танце возвращения на родину. Она была его приоритетом. Конечно, он угрожает убить Питера и всех, кого любит, но это всего лишь реальная угроза. Считайте это «усиленным режимом допроса», как в костюме Человека-паука.

Позже, во время сцены после титров, Тумс сталкивается с бывшим партнером в тюрьме, который просит его выдать секретную личность Человека-паука, чтобы некоторые «парни со стороны» могли его убить.Вместо того, чтобы отказаться от него из мести, он притворяется тупым и ведет себя так, будто понятия не имеет, кто такой Человек-паук. У Стервятника был шанс уничтожить одного из своих самых могущественных врагов, рядом с Железным Человеком и, конечно же, последствиями поздней стадии капитализма, но вместо этого он решил не делать этого. Несмотря на то, что у него была сила , чтобы убить Человека-паука, он сделал ответственную вещь , оставив в живых 15-летнего ребенка. Как будто он понял, что с большой властью приходит большая ответственность. Звучит как девиз настоящего героя, не так ли?

Стервятник должен был подать в суд за нарушение контракта

злодеев в кинематографической вселенной Marvel стали преступниками по нескольким причинам.У Локи были проблемы с отцом, подпитывающие его союз с Таносом для вторжения на Землю. Уилсон Фиск хотел сделать Нью-Йорк лучше с помощью федеральных программ реконструкции (и рэкета) после битвы за Нью-Йорк. Для Адриана Тумса город Нью-Йорк, нарушивший контракт на уборку из-за того, что федеральное правительство претендовало на исключительную юрисдикцию по восстановлению технологии Читаури после битвы за Нью-Йорк, было причиной того, что он стал торговцем оружием-убийцей. Было бы разумнее искать юридического представителя, потому что Тумс должен был подать в суд за нарушение контракта.

Адриан Тумс имел действующий контракт с городом Нью-Йорком на удаление инопланетного оружия, разбросанного по Манхэттену. Тоумс начал выполнение своего контракта и понес расходы на дополнительные автомобили для выполнения своих договорных обязательств. Если бы Damage Control не остановил его выполнение контракта, Toomes участвовал бы в уборке обломков Читаури по всему Манхэттену.

The New York City — Toomes Contract был строительным контрактом, заключенным генералом штата Нью-Йорк.Автобус. Закон § 756, который охватывает все, от сноса и раскопок до улучшения земли. Город Нью-Йорк может заявить, что первоначальный контракт потерял исковую силу из-за того, что федеральное правительство заявило об исключительной юрисдикции в отношении удаления чужих технологий. Если бы это был веский аргумент, это не освободило бы ни город Нью-Йорк, ни федеральное правительство от необходимости платить Тумсу за выполненную работу.

Контракты могут быть лишены исковой силы в соответствии с государственной политикой, если существует 1) законодательство, устанавливающее, что соглашение не может быть исполнено; или 2) если общественный порядок важнее выполнения соглашения.См. В целом Restat 2d of Contracts, § 178 (1) (2nd 1981).

Федеральное правительство было действительно заинтересовано в обеспечении общественной безопасности от инопланетного оружия и технологий, разбросанных по Манхэттену. Принятие закона о создании контроля за ущербом в ответ на сверхчеловеческое разрушение могло бы стать веской причиной для того, чтобы контракт Нью-Йорк — Тумс стал не имеющим законной силы. Однако Toomes уже приступил к работе и потратил значительные средства после заключения контракта с Нью-Йорком.

Адриан Тумс имел обоснованные ожидания, доверие и реституционные интересы в отношении своего контракта с Нью-Йорком.Таким образом, Toomes имеет право на возмещение убытков за нарушение контракта в соответствии с несколькими теориями.

Toomes, как минимум, имеет право на возмещение убытков в размере контрактной цены (или неоплаченной части) за вычетом затрат на завершение (затраты, которых можно избежать, если не довести до конца выполнение). См. Restat 2d of Contracts, § 348 (2) (b). В качестве альтернативы, другая формула возмещения убытков может относиться к завершенной работе плюс оставшаяся часть работы и прибыль, которая была бы получена от этой работы.Murray on Contracts, стр. 682, со ссылкой на Kehoe v. Rutherford, 56 N.J.L. 23, 27, а. 912 (1893).

Это еще не конец анализа ущерба, проведенного Toomes. Toomes потратил значительные средства в соответствии с контрактом И выполнил свои контрактные обязательства, прежде чем Damage Control закрыл его. Toomes будет иметь право на косвенный ущерб в связи с его расходами и выполненной работой, чтобы избежать неоправданного обогащения федерального правительства или города Нью-Йорка.

Средством защиты от нарушения контракта НЕ является незаконное производство оружия с использованием чужих технологий.Адриан Тумс должен был немедленно связаться с адвокатом, чтобы потребовать возмещения ущерба как от города Нью-Йорка, так и от федерального правительства. В то время как оба предполагаемых ответчика указывали друг другу на то, кто несет финансовую ответственность перед Тоумсом, федеральное правительство утверждает, что это г. Нью-Йорк, а город Нью-Йорк [справедливо] утверждает, что нарушение контракта вызвало вмешательство федеральных властей, но добросовестный истец адвокат подал в суд на обоих.

Связанные

Культурный стервятник — Global Times

План промышленного парка Шуган.Фото: любезно предоставлено рекламным отделом Shougang

Будет ли художественный центр, расположенный далеко на западе, привлекать толпу? Фотография: CFP .

В октябре прошлого года Пекинская международная неделя карикатуры 2011 была открыта на старой промышленной базе Шуган (Capital Steel Group), столичного сталелитейного завода в районе Шицзиншань. Ярмарка привлекла внимание публики к мультфильмам. В то же время он привлек внимание к проекту по превращению этой территории в индустриальный парк культуры, искусства и технологий в течение следующего десятилетия.

Хэ Хуаньмэй, ответственный за этот проект, сообщил, что текущая цель, которую они поставили, — превзойти 798 Space как с точки зрения масштаба, так и с точки зрения разнообразия. «Помимо индустрии мультфильмов и анимации, мы представим технологические компании, специализирующиеся на облачных вычислениях, и телекоммуникационные организации, такие как China Unicom», — сказала она. «И наше общее внимание будет сосредоточено на культуре и искусстве», — добавил он.

Он сообщил, что как только они получат официальное разрешение на использование земли в коммерческих целях, строительство парка может произойти очень быстро.«Я думаю, что мы увидим его открытие в начале следующего года», — сказала она Metro Beijing. «Это общий план, и при строительстве необходимо учитывать некоторые другие факторы». Metro Beijing решила выяснить, что это за другие факторы и представляют ли планы реальную конкуренцию 798 и другим культурным центрам.

Не построено за день

Как и 798, проектировщики Shougang хотят использовать старые фабрики. На это указал Хун Фэн, директор Ассоциации продвижения искусства Сунчжуана, промышленной зоны культуры и искусства в районе Тунчжоу.«Использование старых заводов для строительства индустриального парка культуры — не новая идея», — сказал он. «798 — хороший тому пример, и он оказался успешным».

Чжан Лэй, художник, работавший в 798, также сказал Metro Beijing, что старые фабрики являются хорошими ресурсами, которые не только экономят деньги, но и сохраняют местную промышленную историю и культуру. «У нас не так много старых заводов в Пекине, особенно таких, как Shougang, которые существовали десятилетиями», — сказал он. «Так что такие места стоит сохранить как памятник истории региона.«

» «Это хорошо, что Шуган хочет стать новым культурно-ориентированным парком», — сказал Сюй Дун, директор мастерской художественной фотографии около 798. «Это особенно хорошо, чтобы заполнить пустую брешь на западе.

Мастерская Сюя находится в Художественном районе Цаочанди, еще одном творческом районе города. Поселившись там много лет, Сюй может с энтузиазмом относиться к новому проекта, но сказал, что не рассматривает возможность переезда в индустриальный парк Шуган.«Культурной индустрии нужно время, чтобы расти и получить признание в этой области. То же самое можно сказать и о Шуган», — пояснил Сюй. «Я не хочу туда переезжать, потому что Caochangdi уже существует».

Сюй не единственный, кто высказывает такое мнение. Хун сказал, что и зона искусства Сунчжуан, и 798 существовали уже много лет, прежде чем стали великими местами собраний культуры и искусства. «Сунчжуан, например, больше не просто деревня для художников, но и индустриальный парк искусства с разнообразными организациями и отдельными людьми в области кино и музыки», — сказал он.«Здесь воспитывалась культура искусства, и люди не переезжали в другое место, даже когда им предлагали лучшие и более дешевые предложения для художественного пространства в аналогичных условиях».

Получите преимущество

Поэтому культурному центру нужно время, чтобы завоевать популярность. Ему также нужен особый фокус, который может отличить его от других, существующих в Пекине. Хотя он сказал, что индустриальный парк Шуганг не будет 798-м во многих отношениях, остались вопросы о том, насколько он будет отличаться.

«В Пекине более 30 индустриальных парков культуры, и у каждого из них должен быть свой характер, иначе это просто пустая трата», — сказал Хун. «Что касается Shougang, я думаю, это действительно зависит от того, обладают ли люди или организации, которые занимаются этим проектом, хорошими знаниями в этой области». Хонг объяснил, что парк должен придерживаться своего исторического преимущества — быть старой фабрикой, вместо того, чтобы сосредотачиваться на слишком многих аспектах и ​​в конечном итоге стать местом для всех, но не для всех.

По словам Чжана, в парке в Шугане должно быть что-то удивительное, чтобы привлекать сюда людей.«Этот парк действительно находится далеко за пределами центра города, особенно если учесть загруженность дорог, поэтому нужно что-то особенное, чтобы люди посещали его, а не другие», — сказал он.

Сюй также сказал, что 798 и Сунчжуан имеют свои особенности, и Шуган должен делать то же самое. «Многие места по всему Китаю были вдохновлены 798, но, не отличаясь друг от друга, они не преуспели», — сказал он. «Я считаю, что Shougang не должен быть слишком коммерческим, поскольку он не подходит для выращивания различных культур.Сюй добавил, что растущая коммерциализация 798 заставляет некоторых людей и организации переезжать в другое место. Возможно, Шуган извлечет уроки из этого.

Возможно, еще слишком рано делать какие-либо выводы о влиянии этой новой культурной зоны на западный Пекин. сказал, что в таких местах, как 798, вначале поселились только несколько художников. Кто знал, что через несколько лет он превратится в одну из самых влиятельных художественных и культурных зон в городе? Поэтому Шуган стоит посмотреть.


Требуется участие граждан в исследованиях черного стервятника

25 марта 2021 г.
Автор Венди Майер, координатор по связям с общественностью

Стервятники играют роль мусорщиков природы, убирая трупы животных, но что происходит, когда вид переходит от уборки мусора к преследованию и даже охоте на домашний скот?


Пэт Цолльнер, профессор естественных наук, вместе со аспирантом Мэриан Валь и их партнеры с Программа Министерства сельского хозяйства США по охране дикой природы изучает черных стервятников в Индиане, чтобы лучше понять экологию стервятников, а также разработать методы смягчения будущего вреда для домашнего скота Индианы и Кентукки.

«Черные стервятники относительно новы для Индианы и Кентукки, они постепенно переселяются с юга, и прямо сейчас есть много неизвестных, которые нам нужно выяснить, чтобы принимать разумные управленческие решения», — сказал Уол. «Некоторые из насущных вопросов, которые у нас возникают, заключаются в том, сколько у нас здесь черных стервятников, где обитают птицы, как и где происходит конфликт, и насколько эффективны различные подходы к решению проблем с черными стервятниками.

Цель исследования двоякая.Во-первых, они хотят увидеть, что заставляет некоторых черных стервятников становиться агрессивными хищниками домашнего скота, а не просто падальщиками. Во-вторых, они стремятся узнать признаки, по которым можно определить, было ли животное убито стервятниками или просто убито, что является важным доказательством для животноводов, подавших иски в программу возмещения убытков Министерства сельского хозяйства США в надежде получить компенсацию за свои убытки.

Для достижения своих целей исследовательская группа обращается за помощью к животноводам посредством онлайн-опроса, а также с помощью пожертвований телят, предположительно убитых черными стервятниками.

«Стервятники очищают трупы мертвых животных, и это важная роль», — сказал Цолльнер. «Если они встретят мертворожденного теленка, они его съедят, но некоторые из этих птиц охотятся за молодыми животными или даже за телятами, когда они рождаются. Мы недостаточно знаем о биологии этих стервятников, чтобы понять, почему некоторые птицы становятся хищниками, или разницы между тем, как они собирают пищу, и тем, как они убивают животное. Если мы сможем получить достаточно этих хищных телят для изучения, мы сможем этому научиться.”


Опрос, совместная работа Цолльнера, Валя, аспиранта Брук МакВертер и профессор социальных наук о природных ресурсах д-р. Чжао Ма изучит более широкие проблемы, связанные с потерями домашнего скота в штате, в дополнение к оценке опыта производителей с черными стервятниками, как положительного, так и отрицательного. Информация опроса поможет исследователям понять, насколько обширен конфликт с черными стервятниками в регионе, узнав больше о том, где и насколько черные стервятники наносят ущерб, а также поможет им сформулировать более эффективные способы управления этим видом.
г. Онлайн-опрос qualtrics доступен уже сейчас и займет всего 15-20 минут. Опрос является анонимным, и собранные данные должны быть представлены только в сводной форме, а не в виде индивидуальных ответов.
Команда также просит производителей пожертвовать телят, которых, по их мнению, убили черные стервятники. Вскрытие животных будет проводиться бесплатно. Чтобы пожертвовать теленка, позвоните или напишите Wahl на номер 317-647-5294. Более подробная информация о пожертвовании доступна здесь: Свяжитесь с Purdue FNR в случае потери домашнего скота из-за стервятников.
Исследование команды недавно было опубликовано в Perry County News и Spencer County Journal Democrat, а также в мартовском выпуске журнала Говядина по месяцам. Интервью Beef Monthly начинается на 21-й минуте.

Молекулярная характеристика переносчиков органических анионов 1 и 2 Gyps africanus (африканский белоспинный стервятник), экспрессируемых в почках

Abstract

Ранее было показано, что виды Gyps очень чувствительны к токсическим эффектам диклофенака, когда они присутствуют в их пищевых источниках в виде остатков лекарств после использования в ветеринарии.Стервятники, подвергшиеся воздействию диклофенака, вскоре впадают в депрессию и умирают с признаками тяжелой висцеральной подагры и повреждения почек при вскрытии. Молекулярный механизм токсичности и почечной экскреции мочевой кислоты все еще плохо изучен. С клиническими картинами, предполагающими выделение мочевой кислоты почками в качестве целевого участка токсичности, в качестве первого шага было предпринято следующее исследование для определения путей выделения мочевой кислоты, присутствующих у африканского белоспинного грифа ( Gyps africanus ) (AWB), один из видов, подверженных токсичности.Используя анализ транскриптома, иммуногистохимию и функциональные прогнозы, мы продемонстрировали, что AWB использует транспортер органических анионов 2 ( OAT2 ) для их экскреции мочевой кислоты. Анализ RT-qPCR впоследствии продемонстрировал относительно сходную экспрессию транспортера OAT2 у грифов и цыплят. Наконец, док-анализ предсказал, что нестероидные препараты вызывают свою токсичность за счет аллостерического связывания.

Образец цитирования: Nethathe B, Phaswane R, Abera A, Naidoo V (2021) Молекулярная характеристика транспортера 1 и 2 органических анионов Gyps africanus (африканский белоспинный стервятник), экспрессируемого в почках.PLoS ONE 16 (5): e0250408. https://doi.org/10.1371/journal.pone.0250408

Редактор: Адам Кейн, Университетский колледж Дублина, ИРЛАНДИЯ

Поступила: 17 ноября 2020 г .; Одобрена: 6 апреля 2021 г .; Опубликовано: 4 мая 2021 г.

Авторские права: © 2021 Nethathe et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Данные доступны на NCBI для необработанных считываний (PRJNA560189) и гена OAT2 (MK879652). Дополнительные файлы генов доступны в NCBI по номерам MK854995, MN6 и MN6.

Финансирование: Исследование было поддержано Национальным исследовательским фондом, номер гранта CPRR130

589. Арон Абера работает в Inqaba Biotechnology. Финансирование не повлияло на дизайн исследования, сбор и анализ данных, решение о публикации или подготовку рукописи, а только обеспечило финансовую поддержку в виде заработной платы автора и материалов исследования.Спонсор предоставил поддержку в виде заработной платы автору [A.A], но не имел никакой дополнительной роли в дизайне исследования, сборе и анализе данных, решении опубликовать или подготовке рукописи. Поздний автор помог с секвенированием по Сэнгеру.

Конкурирующие интересы: Арон Абера работает в Inqaba Biotechnology. Это не влияет на нашу приверженность политике PLOS ONE в отношении обмена данными и материалами.

1. Введение

Связанная с диклофенаком токсичность и массовая гибель были хорошо задокументированы для трех видов Gyps на азиатском континенте после заражения их источника пищи в результате ветеринарного использования препарата у крупного рогатого скота [1].Несмотря на то, что птицы умирают уже через 48 часов после заражения с беспрецедентной смертностью популяции, превышающей 99%, и миллионы птиц были найдены мертвыми, механизм токсичности остается плохо изученным [2]. Текущие предположения заключаются в том, что токсичность связана с функцией почек в результате патологического обнаружения висцеральной подагры у недавно умерших птиц. Подагра — это патологическое проявление, которое возникает в результате осаждения солей уратов в брюшной полости после достижения точки насыщения плазмы.В качестве вещества мочевая кислота вырабатывается печенью при расщеплении пуринов, как эндогенных, так и экзогенных, и сохраняется в плазме в виде тщательно контролируемой суспензии [3]. Для дальнейшего поддержания последнего гомеостаза почки играют ключевую роль в выведении мочевой кислоты, которая проявляется в виде белого остатка в птичьих экскрементах. Несмотря на важность почечной системы в экскреции мочевой кислоты, путь выделения мочевой кислоты у грифов еще не описан. Тем не менее, было высказано предположение, что угнетение функции почек, вероятно, объясняет развитие подагры.

Из исследований на людях (продуценты низкой мочевой кислоты) известно, что почки способствуют поддержанию гомеостаза, удаляя мочевую кислоту за счет комбинации клубочковой фильтрации и секреции проксимальных извитых канальцев (ПКТ) [4]. В первом случае процесс облегчается перепадом давления в клубочках в зависимости от размера, в то время как последний опосредуется активным транспортным механизмом. Из этих двух ПКТ является более сложным физиологическим процессом, поскольку клетки здесь являются основным физиологическим барьером для пассивной диффузии заряженных гидрофильных молекул из крови в канальцы.Чтобы преодолеть это, клетки используют десятки мембраносвязанных белков-переносчиков; транспортные белки-переносчики растворенных веществ (SLC), идентифицированные как OAT1 OAT4 ( SLC22A6 SLC22A8 для OAT1 OAT3 и SLC22A11 для 21 OAT4 905); белок множественной лекарственной устойчивости ( MRP2 / ABCC2 и MRP4 / ABCC4 ) и уратный транспортер ( URAT1 ) [9, 10].Транспортеры OAT1 и OAT3 локализованы в базолатеральной мембране клеток проксимальных канальцев почек и опосредуют перемещение органических анионов, таких как мочевая кислота, из плазмы в клетки PCT посредством обмена дикарбоксилат / органический анион. В то же время, ко-транспортер натрийзависимого дикарбоксилата (NADC-3) облегчает перенос выведенного из организма дикарбоксилата обратно в клетки. Изнутри клеточной цитоплазмы мочевая кислота секретируется транспортерами MRP2 и MRP4 , расположенными на апикальной клеточной мембране почечных канальцев, в почечные канальцы.Процесс транспортера ОАТ и MRP известен как канальцевая секреция. В то же время мочевая кислота, присутствующая в канальцах, либо от клубочковой фильтрации, либо от канальцевой секреции, может реабсорбироваться обратно в системный кровоток через дикарбоксилатные или гидроксильные ионы и обмен монокарбоксилата посредством OAT4 и URAT1 соответственно, которые также локализованы. в апикальной мембране в процессе, известном как тубулярная реабсорбция [7, 11, 12].

Неудивительно, что при таком сложном механизме гомеостаз мочевой кислоты основан на тонком балансе между клубочковой фильтрацией, канальцевой секрецией и канальцевой реабсорбцией.Этот тонкий баланс зависит от воздействия любого вещества, влияющего на образование мочевой кислоты, или веществ, препятствующих выведению. Для первых диета с высоким содержанием белка может привести к увеличению образования мочевой кислоты, в то время как лекарственные вещества могут ингибировать функциональность транспортных белков. Помимо естественных анионных веществ, ОАТ также участвуют в выведении ряда лекарственных средств, таких как нестероидные противовоспалительные препараты (НПВП), противовирусные препараты и β-лактамные антибиотики [13].При взаимодействии лекарств с переносчиками, исследования также показали, что пробенецид и другие урикозурические препараты, такие как НПВП, в процессе выделения также ингибируют опосредованный ОАТ транспорт многих органических анионов [14], что делает их полезными для лечения подагры у людей. .

Хотя механизм экскреции у стервятника неизвестен, из ограниченной информации у цыплят, выведение мочевой кислоты происходит по тому же механизму, что и у людей, с некоторыми ключевыми отличиями [15].В отличие от млекопитающих, которые в основном используют мочевину в качестве азотсодержащего экскреторного продукта, птицы используют для выведения преимущественно мочевую кислоту, т.е. птицы обладают урикотелином и производят значительно более высокие концентрации мочевой кислоты [15–17]. В результате экскреторные потребности в мочевой кислоте у птиц намного превышают способность клубочковой фильтрации, в результате чего канальцы отвечают за выведение до 80% мочевой кислоты [18]. Чтобы еще больше усилить выведение мочевой кислоты, птицы не реабсорбируют мочевую кислоту, и до сих пор не было описано транспортеров URAT1 .Из исследований [15] с использованием праймеров, полученных из транспортной последовательности ОАТ человека, было описано, что основной путь выделения мочевой кислоты курицы опосредуется транспортерами OAT1 и OAT3 . В связи с отсутствием информации о стервятниках старого мира, в данном исследовании мы пытаемся охарактеризовать белки-переносчики мочевой кислоты как первый шаг в установлении механизма токсичности диклофенака у стервятников. Мы также используем курицу в качестве вида сравнения, так как это единственный вид, не являющийся грифом, продемонстрировал чувствительность к токсическим эффектам диклофенака в лабораторных условиях, хотя и в 10-кратной дозе 10 мг / кг [2].

2. Материалы и методы

2.1. Идентификация перевозчиков, присутствующих в стервятнике

2.1.1. Исследования OAT на почках грифов AWB и домашних кур с использованием опубликованных праймеров.

Перед началом экспериментов этическое разрешение для сбора образцов было проведено в соответствии с руководящими принципами и правилами, утвержденными Комитетом по этике животных Университета Претории (AEC) (номер проекта: V108-16). Транспортеры мочевой кислоты оценивали у двух взрослых AWB ( Gyps africanus ), которые были подвергнуты эвтаназии по медицинским показаниям.Для контроля при необходимости использовали почечную ткань курицы или мыши. Для AWBV1 и курицы общую РНК экстрагировали из образцов почек с использованием набора RNeasy plus mini (Qiagen) в соответствии с инструкциями производителя и хранили при -80 ° C для обратной транскрипции. Обратную транскрипцию проводили с использованием набора ClontechSmart MMLV Reverse Transciptase согласно инструкции производителя. OAT3 куриных праймера (прямой 5`CCCTTCTTCCTCTTCTTCCTCG-3` и обратный 5`-TGGATCAGATAAATGCTGACCCC-3`), описанные в [15], использовали для частичной амплификации (праймер, поставляемый Integrated DNA Technologies, Южная Африка).Реакции ПЦР были подготовлены с использованием набора Fermentors в соответствии с инструкциями производителя. Условия амплификации были следующими: 38 циклов с денатурирующей температурой 94 ° C, температурой отжига 61,6 ° C и температурой удлинения 72 ° C [15]. Ампликоны секвенировали на генетическом анализаторе ABI 3500X1 (Inqaba Biotechnology, ЮАР). Сравнения выравнивания проводили с последовательностью (BBSRC Chick EST ID 603812145F1), описанной в [15]. Полученная последовательность также была дополнительно проанализирована с использованием алгоритма blastn в Национальном центре биотехнологической информации (NCBI) [19].

2.1.2. Анализ транскриптома ОАТ у грифов AWB.

Для секвенирования следующего поколения суммарную РНК экстрагировали из указанной выше почки стервятника AWB и последовательности в Совете по сельскохозяйственным исследованиям (ARC) (Ондерстепорт, Претория, Южная Африка). кДНК секвенировали с использованием набора для подготовки цепочечных Ran мРНК Illuminia Truseq на химической модели Hiseq 2500 v4 2 x 125 пар оснований. Результатом, полученным в результате секвенирования, было 50 миллионов коротких считываний длиной 125 нуклеотидов каждое. Последующий анализ был проведен на платформе Galaxy с использованием FASTQC [20], после чего адаптеры были удалены с помощью Trimmomatic [21].Предварительно обработанные чтения были собраны в транскрипты с помощью TRINITY [22]. Собранный транскриптом был преобразован в локальную базу данных Blast, и последовательности OAT1 и OAT2 были идентифицированы на основе предсказанных последовательностей из Golden Eagle OAT1 (XM_011601043.1) и OAT2 (XM_011585794.1). Беркут был выбран, поскольку было показано, что эти два вида тесно связаны [23].

2.1.3. Подтверждение генов транскриптома AWB
OAT1 и OAT2 с использованием секвенирования по Сэнгеру.

Свежую тотальную РНК экстрагировали из ткани почек второго грифона AWB, чтобы предотвратить эффект накопления, с использованием набора Quick RNA Miniprep от Zymo Research (США). Синтез кДНК проводили с использованием набора Lunascript RT supermix kit от New England Biolabs (NEB) (США). Праймеры для OAT1 и OAT2 были сконструированы на основе последовательностей транскриптомов: OAT1 (F): GACCTTGTCTGCAGCTACCG; OAT1 (R): CCAGAGCTGCTTTATTCCTCCAAG; OAT2 (F): CTCATGTTGCTGCTCCTTAGTACA и OAT2 (R): CTAGGTGGACAGTAAAGGCTCTTT.ПЦР выполняли с использованием набора для полимеразы One taq от NEB. Протокол амплификации был следующим: Начальная денатурация 94 ° C в течение 30 секунд, 40 циклов (денатурация 94 0 C в течение 30 секунд; отжиг 55 0 C в течение 30 секунд и удлинение 68 0 C в течение 2 минут) и окончательное удлинение 68 ° C в течение 5 мин. Очищенные продукты ПЦР секвенировали на генетическом анализаторе ABI 3500X1.

2.1.4. Филогенетический анализ.

Полученные прямые и обратные последовательности Сэнгера ОАТ стервятника AWB выравнивали с использованием Clustal Omega [24] для получения консенсусных последовательностей.Для построения филогенетического дерева 26 ( OAT1 ) и 39 ( OAT2 ) близкородственных видов птиц с более чем 85% сходством с грифом AWB OAT1 и OAT2 были извлечены из Genbank. Виды птиц, загруженные из Genbank (NCBI), принадлежат к следующим отрядам: Papaeognathae, Galoanseres, и большинство видов были Neoaves. Скачанные таксоны были сопоставлены с использованием мышечного алгоритма (программный пакет Molecular Evolutionary Genetics Analysis версия X (MEGA X) [25, 26]).После выравнивания пробелы были классифицированы как недостающие данные. Генетическое расстояние и статистика нуклеотидного состава всех таксонов были рассчитаны в версии MEGA X. Филогенетические отношения были построены с использованием оценки максимального правдоподобия (ML) модели Тамура-Неи и модели General Time Reversible [27, 28]. Для оценки узловой надежности был проведен бутстреп-анализ с 1000 повторениями топологий филогенетического дерева [29]. Инвентарные номера ОАТ (1 и 2) от различных видов птиц, включенных в филогенетическое древо, перечислены в (Таблица S1).

2.2. Прогнозирующая функциональность белков

2.2.1. Белковая местность.

Перед инкубацией с первичными антителами был использован анализ последовательности, чтобы сначала показать сходство между сайтом связывания поликлонального кроличьего анти-OAT3 антитела (Whitehead Scientific, Южная Африка) и AWB OAT1, соответствующей последовательности иммуногена KKEEGERLSL EELKLNLQKE ISLAKAKYTA SDLFRIPMLR при 72% сходстве . Почки трехдневных самок мышей CD1 (n = 5) использовали в качестве контроля, поскольку последовательности OAT1 не были зарегистрированы у цыплят.Почки сохранены иммерсионной фиксацией. Метод, описанный ранее в [30], был использован с некоторыми изменениями. Почки на короткое время перфузировали фосфатно-солевым буфером (PBS) при осмоляльности 298 мОсм / кг ч 3О (pH 7,4) для удаления всей крови с последующей перфузией 2% -ным раствором периодат-лизин-параформальдегид (PLP) в течение 10 мин. После перфузии почки удаляли и разрезали на срезы (толщиной 1-2 мм), которые затем фиксировали погружением в тот же фиксатор на ночь при 4 ° C.После фиксации почки заливали воском и разрезали в поперечном направлении толщиной 4 мкм с помощью микротома. Срезы были обработаны для иммуногистохимии с использованием метода непрямой иммунной пероксидазы. Все срезы трижды промывали PBS, содержащим 50 мМ Nh5Cl, в течение 15 мин. Срезы сначала обрабатывали дозированной серией этанола, а затем инкубировали в течение 4 ч с раствором A (PBS, содержащий 1% бычий сывороточный альбумин (BSA), 0,05% сапонина и 0,2% желатина). После этого срезы тканей инкубировали в течение ночи при 4 ° C с антителами (1: 3000), разведенными в растворе A.

После нескольких промывок в растворе B (PBS, содержащий 0,1% BSA, 0,05% сапонина и 0,2% желатина) срезы тканей инкубировали в течение 2 часов в конъюгированных с авидин-биотин-пероксидазой козьих анти-кроличьих IgG (H + L) Fab-фрагмент (White head Scientific, Южная Африка) разбавляли 1: 100 в растворе C (PBS, содержащий 1% BSA). Затем образцы промывали в растворе B, а затем в 0,05 М Трис-буфере (pH 7,6). Для обнаружения авидин-биотин-пероксидазы срезы инкубировали в 0,1% 3,3’диаминобензидине (DAB, Sigma) в 0.05 М Трис-буфер в течение 5 мин; Добавляли H 2 O 2 до конечной концентрации 0,01% и инкубацию продолжали в течение 10 минут. Срезы трижды промывали 0,05 М трис-буфером, дегидратировали с помощью этанола с постепенным изменением концентрации. Все образцы исследовали с помощью светового микроскопа.

2.2.2. Анализ предсказания белка.

Полученные последовательности OAT1 и OAT2 были преобразованы с помощью Expasy в белковые последовательности и установлена ​​открытая рамка считывания.После того, как выведенные аминокислотные последовательности были проанализированы с помощью следующих программ для предсказания трансмембранной спирали с использованием TMHMM [31] и PHYRE2 (механизм распознавания гомологии белков) с помощью Scan Prosite [32] для предсказания трехмерных структур и / или функциональности. Сайты N -гликозилирования были предсказаны с использованием базы данных последовательностей PROTTER [33], а другие возможные сайты постгликозилирования и фосфорилирования были исследованы с помощью исследований базы данных Expasy. Транспортеры ОАТ были также проанализированы с помощью TrSSP (Сервер предсказания специфичности транспортеров субстратов) [34], чтобы установить, является ли предсказанный белок, вероятно, транспортером анионов.

2.2.3. Экспрессия транспортера органического аниона 2.

Для OAT2 , обратная транскриптаза (RT) -qPCR была выполнена на кДНК грифов AWB и курицы (матрица), нацеленной на GAPDH (ген домашнего хозяйства) [35], и для отрицательного контроля матрица не добавлялась. с использованием специфических праймеров: курицаOAT2_F: ACCATCTCCACTGAGTGGGAC, курицаOAT2_R: CGGCCGAACCTGTCTGAAAG и стервятникOAT2_F: CATCTCCACGCAGTGGGAC, vultureOAT2_R: CGTCCGAACCTGTCTGAAAGG. Все реакции проводили на системе обнаружения ПЦР в реальном времени CFX96.Условия термоциклирования для RT-qPCR были следующими: 1 цикл при 95 ° C в течение 60 секунд, 40 циклов амплификации при 95 ° C в течение 15 секунд и отжиг при 60 ° C в течение 30 секунд. Среднее значение цикла количественного определения (Cq) определяли с использованием ручных настроек количественного определения и нормализовали с использованием значений GAPDH Cq. Используемая формула была следующей: нормализованный OAT2 Cq = OAT2 Cq — GAPDH Cq [35].

2.2.4. Оценка докинга белков.

На основании результата специфичности переносчика и N -гликозилирования было выполнено прогнозируемое связывание лекарственного средства с OAT2 .Основной карман был оценен fPocket через платформу PHYRE2, поскольку большие карманы обычно считаются сайтами связывания. Аффинность специфического связывания диклофенака и уратов с транспортерами OAT2 курицы, стервятника или человека оценивали на молекулярном уровне в Swissdock с использованием матричной структуры, созданной PHYRE2, и запускали в автоматических настройках. Получили результирующую ΔG между уратом и диклофенаком и другими НПВП (мелоксикам, кетопрофен, карпрофен, нимесулид и толфенамовая кислота).Поскольку точка связывания диклофенака не известна, его сайт связывания был принят за точку с наивысшим сродством диклофенака или мочевой кислоты. Когда их соответствующие наиболее сильные аффинности различались, определяли ΔG перекрывающегося связывания с использованием сайта связывания диклофенака в качестве вероятной точки прикрепления.

3. Результаты

3.1. Идентификация транспортеров OAT, присутствующих в стервятнике AWB, с использованием опубликованных праймеров, секвенирования следующего поколения и Сэнгера

Плохая амплификация была достигнута у стервятника AWB с использованием праймеров OAT3 , опубликованных Duda et al.(2005) [15]. В отличие от курицы, сгенерированная последовательность выровнена с опубликованной частичной последовательностью OAT3 (BBSRC Chick EST ID 603812145F1, 556 пар оснований) и обнаружила сходство 97,11%, что указывает на то, что праймеры амплифицировали правильный сегмент. При бласт-анализе сгенерированная последовательность курицы была, однако, аналогична последовательности OAT1 других видов птиц с наивысшим сходством 83% с Pelecanus crispus (далматинский пеликан) и 81,4% с Aquila chrysaetos (золотистый). eagle) без очевидного сходства с какой-либо опубликованной последовательностью курицы.Кроме того, в базе данных NCBI отсутствовала частичная последовательность цыпленка OAT3 . Более того, транспортер OAT3 , насколько мы могли установить, не был описан ни у одного вида птиц в базе данных NCBI. Это заставляет нас предположить, что праймеры, опубликованные в [15], скорее амплифицировали OAT1 . В последующем анализе внимание было уделено только OAT1 и OAT2 .

В качестве следующего шага в анализе мы вернулись к полному анализу транскриптома.Используя извлеченную тотальную РНК и секвенирование следующего поколения, необработанные считывания (PRJNA560189) почечного образца были собраны в Trinity. Используя предсказанные золотым орлом последовательности для OAT1 и OAT2 в качестве эталона, последовательности AWB выровнены с первым со сходством 98,89 и 98,07% соответственно ( OAT1 -MN6; OAT2 -MN6). Эти последовательности впоследствии были подтверждены с использованием секвенирования по Сэнгеру (рис. 1) с хорошим сходством для OAT1 (MK854995) и OAT2 (MK879652) на 98.81 и 99,34% соответственно. Сходство последовательности Сэнгера с цыпленком OAT2 составляло 88,05% ( OAT1 у цыплят еще не идентифицировано).

Рис. 1. Обычный ПЦР-амплифицированный ген OAT1 и OAT2 из почек стервятника AWB, продукт не был получен, когда матрица была опущена, размер молекулы (100 п.н.) указан слева.

NTC = без управления шаблоном.

https://doi.org/10.1371/journal.pone.0250408.g001

3.2. Филогенетический анализ на основе последовательностей Сенгера

Анализ включал 26 и 39 нуклеотидных последовательностей, и в окончательном наборе данных было всего 1427 и 1626 позиций для OAT1 и OAT2 в указанном порядке. Сходство прежних видов представлено цифрами на внутренних узлах ветвей (рис. 2). Полученные деревья максимального правдоподобия для OAT1 и OAT2 выявили тесную взаимосвязь между стервятником AWB и таксонами орла, в то время как стервятник AWB и курица не имели одной и той же клады.

Рис. 2.

Реконструкция филогенетических отношений между генами (A) OAT1 и (B) OAT2 у видов птиц. Дискретное гамма-распределение использовалось для моделирования различий в скорости эволюции между сайтами (5 категорий (+ G, параметр = 0,5011 и 0,4500)) соответственно.

https://doi.org/10.1371/journal.pone.0250408.g002

3.3. Анализ функциональности белков и прогнозы

3.3.1. Белковая местность.

При наличии поликлональных антител кролика OAT3 это был первый этап предпринятого функционального анализа.Для области связывания поликлонального антитела OAT3 мыши было 72,09% сходства с последовательностью Сэнгера стервятника OAT1 , была проведена иммуногистохимия, чтобы установить распределение OAT1 в почке AWB. Почки мыши использовали в качестве контроля, поскольку коммерческие поликлональные антитела, как ранее было показано, эффективны для мышей. Курица не была включена в этот анализ, поскольку последовательность OAT1 не присутствовала в базе данных NCBI для курицы.Световая микроскопия восковых срезов 4 мкм продемонстрировала иммуноокрашивание почки стервятника AWB в базолатеральной мембране проксимальных извитых канальцев (ПКТ) (рис. 3), что также наблюдалось для почки мыши. Некоторая иммунореактивность также наблюдалась в последних почках на клетках дистальных извитых канальцев и кортикальном собирательном канальце.

3.3.2. Особенности белков-переносчиков.

В последующем прогностическом анализе белка инструмент Expasy (protparam) предсказал, что белок AWB vulture OAT1 состоит из 449 аминокислот с молекулярной массой 44748.10, тогда как стервятник AWB OAT2 состоял из 553 аминокислот с молекулярной массой 57281,49. Анализ доменов с помощью сканирования Prosite и Phyre2 предсказал, что эти белки связаны с мембранно-связанными транспортными белками, которые являются частью суперсемейства основных фасилитаторов (или семейства переносчиков растворенных веществ), которое транспортирует сахара и другие субстраты через клеточную мембрану. Для Phyre2 анализ домена по сравнению с аналогичным белком был представлен с достоверностью 100%. Функциональное предсказание с помощью TrSSP показало, что оба белка являются функциональными переносчиками анионов.База данных последовательностей PROTTER, использованная для предсказания сайтов гликозилирования N- , показала, что OAT1 имел 10 предполагаемых трансмембранных спиралей и не имел сайтов N -гликозилирования как для беркутов, так и для грифов AWB. OAT2 имел 11 трансмембранных спиралей, состоящих из пяти N — сайтов гликозилирования, обнаруженных в положениях 31, 66, 73, 294, 330 для стервятника AWB, в то время как беркут имел 12 трансмембранных спиралей, а также 5 сайтов N -гликозилирования в 68, 103, 110, 331, 3367.Трансмембранная топология предсказывала, что у стервятника AWB OAT1 присутствуют как внутриклеточные, так и внеклеточные петли, в то время как человеческий OAT1 состоит только из одной внутриклеточной петли. Гриф OAT2 состоит из одной внутриклеточной петли, как и у цыпленка OAT2 (фиг. 4).

Рис. 4.

Прогнозируемый трехмерный и двумерный переносчик органических анионов 2 (OAT2) из ​​курицы (A) и африканского белоспинного стервятника (AWB) (B). Вставки — это идентифицированный главный карман (красный).Черная стрелка — это предполагаемый сайт (ы) связывания НПВП, который представляет собой только диклофенак для курицы и несколько НПВП для стервятника, для которых доступна информация о токсичности. Красные стрелки — это предполагаемые сайты связывания уратов. Предсказанная внутриклеточная петля курицы (C) и переносчик органических анионов AWB (D) 2. Графическое изображение (E) AWB OAT1, представляющего 10 трансмембранных спиралей и отсутствие сайтов мотивов N-гликана, и (F) AWB OAT2, представляющего 11 трансмембранных спиралей и 5 сайтов мотивов N-гликанов.

https://doi.org/10.1371/journal.pone.0250408.g004

3.4. Экспрессия AWB и цыпленка

OAT2 с использованием ПЦР с обратной транскриптазой в реальном времени (RT-qPCR)

Уровни экспрессии OAT2 определяли на основе AWB и образца почек цыпленка. Наблюдалась небольшая разница в пиках амплификации OAT2 между цыпленком и грифом AWB, экспрессируемыми в циклах 20,53 и 22,17 соответственно. Для устранения предвзятости кривая плавления после RT-qPCR гена домашнего хозяйства (GAPDH) была также оценена для обоих видов.Результаты кривой плавления для OAT2 обеих птиц подтвердили наличие небольшого различия. Нормализованные уровни экспрессии OAT2 для курицы и стервятника AWB наблюдались при циклах количественной оценки (cq) 6,609 и 6,947 соответственно.

3,5. Анализ стыковки

Для окончательного анализа мы попытались предсказать, как диклофенак будет взаимодействовать с транспортером OAT2 , предполагая, что структура белка не изменится при связывании. Предполагалось, что у каждого транспортера будет один большой карман.Свободная энергия связывания предсказывала, что наиболее сильные сайты связывания для диклофенака и мочевой кислоты находятся в разных точках. Для мочевой кислоты это было ΔG -7,4 ккал / моль как для стервятника, так и для курицы и -6,2 ккал / моль для человека. Напротив, ΔG составляла -8,6, -6,8 и -7,7 ккал / моль для диклофенака, соответственно, для стервятника, курицы и человека. Предполагая, что связывание диклофенака происходит в фиксированном сайте, когда мочевая кислота перекрывается с этим конкретным сайтом, ΔG мочевой кислоты у стервятника и курицы составляет -5.5 и -5,7 ккал / моль соответственно. У людей не было перекрывающихся участков. По сравнению с другими НПВП; мелоксикам, кетопрофен, карпрофен, нимесулид и толфенамовая кислота имеют общий сайт связывания с ΔG -7,53, -8,32, -7,47, -8,24 и -7,7 ккал / моль (рис. 4). Однако это интересное открытие требует дальнейшей оценки.

4. Обсуждение

Поскольку токсичность диклофенака для стервятников была связана со значительным увеличением концентрации мочевой кислоты в плазме, следующее исследование было сосредоточено на идентификации органических анионных переносчиков, присутствующих в почках стервятника, с использованием методов молекулярной биологии и начиная с информации, доступной для курицы и курицы. млекопитающие.Неожиданно было обнаружено, что в то время как частичный транскрипт OAT3 был успешно идентифицирован у цыплят, как описано Dudas et al. (2005) [15], для стервятника амплификации достигнуто не было. Кроме того, бласт-анализ продемонстрировал сходство только частичного транскрипта цыпленка с генами OAT1 других видов птиц, но не с транскриптомом цыпленка. Это привело к заключению, что частичная последовательность OAT3 , ранее идентифицированная у кур, вероятно, была неправильно классифицирована и что исследование, вероятно, идентифицировало OAT1 .Кроме того, насколько нам удалось выяснить, OAT3 не были идентифицированы у птиц ни в каких других исследованиях. Также неизвестно, почему частичные последовательности OAT1 , идентифицированные для курицы, не присутствовали в базе данных NCBI, и почему не сообщается, что OAT1 встречается у цыплят. Вероятно, это указывает на то, что OAT2 является единственным функционально экспрессируемым у цыплят. OAT2 , как было обнаружено, экспрессируется по-разному, а также был идентифицирован как высоко экспрессируемый у мышей.

Для дальнейшей оценки ОАТ, присутствующих в почке стервятника, секвенирование следующего поколения и сборка Trinity выявили присутствие OAT1 с 1468 п.н. и OAT2 с генами 2300 п.н., оба с более чем 98% сходными с генами беркута. Это было впоследствии подтверждено секвенированием по Сэнгеру как 1350 пар оснований и 1662 пар оснований для транспортеров OAT1 и OAT2 соответственно, с до 99% сходства с последовательностями, собранными NGS. Очевидная разница, вероятно, была результатом использования для анализа разных птиц.Последующий филогенетический анализ показал большое разнообразие переносчиков ОАТ, описанных до сих пор у различных видов птиц, что может быть связано с эволюцией, мутациями; гендер и окружающая среда. Разнообразие в последовательности, вероятно, также объясняет, почему куриный праймер [15] не амплифицировал ген стервятника OAT3 / OAT1 . Тем не менее, переносчик ОАТ был более консервативен в семействе Accipitrid (стервятники и клады орлов), что неудивительно из-за сходства в рационе и чувствительности к диклофенаку, как у степного орла ( Aquila nipalensis ).Пока что в естественных условиях степные орлы являются единственным видом, не являющимся грифом, который также чувствителен к действию диклофенака [36]. В своем исследовании Sharma et al. (2014) [36] пришли к выводу, что диклофенак может быть токсичным для других хищников Accipitrid. Исходя из этого результата, можно утверждать, что филогения генов OAT1-2 у видов птиц может быть полезна при построении прогнозной модели, если гены OAT1 и OAT2 могут быть секвенированы у видов, вызывающих озабоченность. Хотя потребуется дальнейшая оценка, если такая связь действительно существует, она принесет огромную пользу в будущих исследованиях токсичности, поскольку суррогатные виды, не находящиеся под угрозой исчезновения, могут ускорить текущие исследования, направленные на оценку токсичности других НПВП.

Затем, чтобы понять функциональность идентифицированных белков OAT, был проведен ряд оценок. По возможности сравнивали с курицей, поскольку этот вид является наиболее изученным птицем с точки зрения экскреции мочевой кислоты, а также по еще не объясненной причине, поскольку вид также подвержен токсическому действию диклофенака. Для первой из этих оценок местоположение переносчика ОАТ определяли с помощью иммуногистохимии. Для этого мы использовали коммерческие поликлональные антитела OAT3 , описанные для мыши, поскольку доступные антитела показали хорошее перекрытие с последовательностью OAT1 стервятника 72% .Кроме того, использовали поликлональные клетки, поскольку они с большей вероятностью связывались с нецелевыми видами. После окрашивания распределение транспортера OAT1 было локализовано в проксимальном извитом канальце. Этот результат согласуется с предыдущими исследованиями, показывающими, что OAT1 локализован на базолатеральной мембране проксимальных извитых канальцевых клеток у др. Видов [17, 37-39]. Хотя антитела OAT2 и не присутствовали для подобной оценки, у нас нет оснований полагать, что его распределение будет отличаться от OAT1 , поскольку два белка экспрессируются вместе одной и той же клеткой у других видов [7, 11, 12] .

Для следующего шага мы выяснили, будет ли транспортер эффективен в своей области экспрессии с помощью моделирования in silico . Хотя моделирование показало, что OAT1 и OAT2 являются белками-переносчиками, мы полагаем, что только OAT2 является переносчиком анионов, т.е. OAT1 может не быть функциональным переносчиком. Мы основали свой вывод на отсутствии сайтов гикозилирования для OAT1 , которые присутствовали для OAT2 .Исследования Tanaka et al. (2004) [40], показали, что, хотя гликозилирование не влияет на функциональность белка, оно играет важную роль в прикреплении белка к плазматической мембране, т.е. эти белки обычно находятся внутри внутриклеточных везикул и должны перемещаться. / перемещаются к клеточной мембране, чтобы стать функциональным, что маловероятно в отсутствие сайтов гликозилирования. В своих исследованиях Tanaka et al. (2004) и Zhou et al. (2005) [40, 41] смогли продемонстрировать, что удаление всех сайтов гликозилирования привело к тому, что транспортеры (человеческий OAT1 и OAT4 ) оказались захваченными во внутриклеточном компартменте, где они стали неэффективными из-за своего местоположения.Используя это открытие, можно предположить, что OAT1 неактивен в качестве переносчика у стервятника или, что еще более вероятно, что предсказанная последовательность для орла на самом деле не является переносчиком OAT1 . Последнее может также объяснить, почему анализ in silico с TrSSP не предсказал анионной активности для этого белка и, возможно, почему OAT1 еще не идентифицирован у цыплят. Однако для подтверждения этого открытия следует провести исследования транспорта органических анионов в присутствии специфических ингибиторов отдельных транспортных белков ОАТ с использованием анализов клонирования in vitro.

Когда OAT2 считался функциональным белком, последним шагом было определение уровня экспрессии белка по сравнению с цыпленком. Хотя RT-qPCR смогла подтвердить, что OAT2 экспрессировался на одинаковом уровне как у курицы, так и у стервятника, уровень экспрессии, скорректированный геном домашнего хозяйства, показывает, что экспрессия между видами различалась в 1,3 раза, что, вероятно, важный вывод. При сравнении стервятника и курицы оба вида чувствительны к токсическому воздействию однократной дозы диклофенака.Однако курица менее чувствительна с зарегистрированной LD50 (средняя летальная доза) около 10 мг / кг, в то время как LD50 для AWB составляла около 0,8 мг / кг [1, 42–44]. Небольшая разница в экспрессии может быть определяющим признаком различий в восприимчивости видов к токсичности. Более того, 12-кратное различие в LD50 также можно объяснить различиями в аминокислотной последовательности ОАТ, а также вариабельным взаимодействием диклофенака с ОАТ2 у обоих видов. В качестве следующего шага было бы интересно сравнить экспрессию OAT2 стервятника с видами, которые слабо восприимчивы к токсическому действию диклофенака, такими как утка ( Anas platyrhynchos ) или голубь ( Columbidae ) [45] .

5. Заключение

В этом исследовании мы пришли к выводу, что почка стервятника AWB экспрессирует мРНК OAT1 и OAT2 , но не OAT3 . Кроме того, с помощью моделирования insilico, предсказывающего, что у белка OAT1 отсутствуют сайты гликозилирования, возникают сомнения относительно эффективности OAT1 в качестве переносчика. Это наводит на мысль, что OAT2 , вероятно, является основным переносчиком мочевой кислоты у грифов AWB. Кроме того, исследования экспрессии, показывающие небольшие различия в уровнях экспрессии OAT2 у курицы и стервятника, могут объяснить незначительные различия в чувствительности к диклофенаку между этими двумя видами.Чтобы усилить результаты, приведенные выше, необходимо провести другие исследования, чтобы выяснить, где транспортер OAT2 функционирует на базолатеральной мембране.

Благодарности

Исследование также стало возможным благодаря поддержке VulPro, которая предоставила стервятников, и UPBRC, которая получила ткани мышей и курицы.

Ссылки

  1. 1. Oaks JL, Gilbert M, Virani MZ, Watson RT, Meteyer CU, Rideout BA и др. Остатки диклофенака как причина сокращения популяции стервятников в Пакистане.Природа. 2004 февраль; 427 (6975): 630–3. pmid: 14745453
  2. 2. Найду В., Лебедь Г.Е. Токсичность диклофенака у грифов связана со снижением экскреции мочевой кислоты, а не с почечной портальной вазоконстрикцией. Сравнительная биохимия и физиология, часть C: токсикология и фармакология. 2009, 1 апреля; 149 (3): 269–74. pmid: 18727958
  3. 3. Сканы CG, редактор. Птичья физиология Стурки. Эльзевир; 2014, 30 июня. Https://doi.org/10.1371/journal.pone.0093649 pmid: 24733125
  4. 4.Maesaka JK, Fishbane S. Регулирование почечной экскреции уратов: критический обзор. Американский журнал болезней почек. 1998, 1 декабря; 32 (6): 917–33. pmid: 9856507
  5. 5. Sweet DH, Pritchard JB. Молекулярная биология почечных переносчиков органических анионов и органических катионов. Биохимия и биофизика клетки. 1999, 1 февраля; 31 (1): 89–118. pmid: 10505670
  6. 6. Павлова А, Сакураи Х, Леклерк Б., Байер Д.Р., Ю.А.С., Нигам СК. Регулируемая в процессе развития экспрессия переносчиков органических ионов NKT (OAT1), OCT1, NLT (OAT2) и Roct.Американский журнал физиологии-физиологии почек. 2000, 1 апреля; 278 (4): F635–43. pmid: 10751225
  7. 7. Ванверт А.Л., Гионфриддо MR, Sweet DH. Органические переносчики анионов: открытие, фармакология, регулирование и роль в патофизиологии. Биофармацевтика и утилизация лекарств. 2010 Янв; 31 (1): 1–71.
  8. 8. Буркхардт Г. Транспорт лекарств переносчиками органических анионов (ОАТ). Фармакология и терапия. 2012 г., 1 октября; 136 (1): 106–30.
  9. 9. Смитс PH, ван Обель Р.А., Воутерс А.С., ван ден Хеувел Дж.Дж., Рассел Ф.Г.Вклад белка 2 множественной лекарственной устойчивости (MRP2 / ABCC2) в почечную экскрецию п-аминогиппурата (ПАУ) и идентификация MRP4 (ABCC4) как нового переносчика ПАУ. Журнал Американского общества нефрологов. 1 ноября 2004 г.; 15 (11): 2828–35. pmid: 15504935
  10. 10. Шин Х.Дж., Такеда М., Эномото А., Фудзимура М., Миядзаки Х., Анзай Н. и др. Взаимодействие уратного транспортера URAT1 в почках человека с урикозурическими препаратами. Нефрология. 2011 Февраль; 16 (2): 156–62. pmid: 21272127
  11. 11.Сладкий DH. Члены семейства переносчиков органических анионов (Slc22a) как медиаторы токсичности. Токсикология и прикладная фармакология. 2005 1 мая; 204 (3): 198–215. pmid: 15845414
  12. 12. Сладкий DH. Почечный транспорт органических катионов и анионов: от физиологии к генам. 2010; 23–53.
  13. 13. Burckhardt BC, Burckhardt G. Транспорт органических анионов через базолатеральную мембрану клеток проксимальных канальцев. В Обзоре физиологии, биохимии и фармакологии 2003 г. (стр.95–158). Шпрингер, Берлин, Гейдельберг. https://doi.org/10.1007/s10254-002-0003-8 pmid: 12605306
  14. 14. Cuthbert R, Green RE, Ranade S, Saravanan S, Pain DJ, Prakash V и др. Быстрое сокращение численности египетского стервятника (Neophron percnopterus) и рыжего стервятника (Sarcogyps calvus) в Индии. Сохранение животных. 2006 август; 9 (3): 349–54.
  15. 15. Дудас П.Л., Пелис Р.М., Браун Э.Дж., Ренфро Дж.Л. Трансэпителиальный транспорт уратов эпителием проксимальных канальцев почек птиц в первичной культуре.Журнал экспериментальной биологии. 2005 15 ноября; 208 (22): 4305–15. pmid: 16272253
  16. 16. Long S, Skadhauge E. Выделение почечной кислоты у домашней птицы. Журнал экспериментальной биологии. 1 мая 1983 г., 104 (1): 51–8.
  17. 17. Синклер, доктор медицины, Мили К.Л., Мэтьюз Н.С., Пек К.Э., Тейлор Т.С., Беннетт Б.С. Сравнительная фармакокинетика мелоксикама у клинически здоровых лошадей и ослов. Американский журнал ветеринарных исследований. 2006 июнь; 67 (6): 1082–5. pmid: 16740106
  18. 18.Бергер Л., Юй Т.С., Гутман А.Б. Влияние препаратов, изменяющих экскрецию мочевой кислоты у человека, на клиренс мочевой кислоты у цыплят. Американский журнал физиологии — наследие. 1 марта 1960 г., 198 (3): 575–80.
  19. 19. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д.. Базовый инструмент поиска локального выравнивания. Журнал молекулярной биологии. 5 октября 1990 г., 215 (3): 403–10. pmid: 2231712
  20. 20. Эндрюс С.Ф., Крюгер Ф., Секундс-Пишон А., Биггинс Ф., Уингетт Ф. Инструмент контроля качества для данных последовательности с высокой пропускной способностью.Бабрахам Биоинформатика. 2014. pmid: 25494900
  21. 21. Bolger AM, Lohse M, Usadel B. Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика. 2014 1 августа; 30 (15): 2114–20. pmid: 24695404
  22. 22. Грабхерр М.Г., Хаас Б.Дж., Яссур М., Левин Дж.З., Томпсон Д.А., Амит И. и др. Сборка полноразмерного транскриптома из данных RNA-Seq без эталонного генома. Биотехнология природы. Июль 2011 г .; 29 (7): 644–52. pmid: 21572440
  23. 23. Адаварен Э.O., Du Plessis M., Suleman E., Kindler D., Oosthuizen A.O., Mukandiwa L. и др. 2020. Полный митохондриальный геном копротер Gyps (Aves, Accipitridae, Accipitriformes): филогенетический анализ митогенома среди хищных птиц. PeerJ , 8, p.e10034. pmid: 33240589
  24. 24. Сиверс Ф., Вильм А., Дайнин Д., Гибсон Т. Дж., Карплюс К., Ли В. и др. Быстрое и масштабируемое создание высококачественного выравнивания множественных последовательностей белков с помощью Clustal Omega. Молекулярная системная биология. 2011; 7 (1): 539.pmid: 21988835
  25. 25. Кумар С., Стечер Г., Ли М., Князь С., Тамура К. MEGA X: анализ молекулярной эволюционной генетики на вычислительных платформах. Молекулярная биология и эволюция. 2018 1 июня; 35 (6): 1547–9. pmid: 29722887
  26. 26. Эдгар Р.С., Бацоглу С. Множественное выравнивание последовательностей. Современное мнение в структурной биологии. 2006 г., 1 июня; 16 (3): 368–73. pmid: 16679011
  27. 27. Тамура К., Неи М. Оценка количества замен нуклеотидов в контрольной области митохондриальной ДНК у людей и шимпанзе.Молекулярная биология и эволюция. 1993 1 мая; 10 (3): 512–26. pmid: 8336541
  28. 28. Неи М., Кумар С. Молекулярная эволюция и филогенетика. Издательство Оксфордского университета; 2000 27 июля
  29. 29. Фельзенштейн Дж. Пределы уверенности в филогении: подход, использующий бутстрап. эволюция. Июль 1985 г., 39 (4): 783–91. pmid: 28561359
  30. 30. Hwang JS, Park EY, Kim WJ, Yang CW, Kim J. Экспрессия OAT1 и OAT3 в дифференцировке проксимальных канальцев почки мыши.Гистология и гистопатология. 2010. pmid: 19924639
  31. 31. Krogh A, Larsson B, Von Heijne G, Sonnhammer EL. Прогнозирование топологии трансмембранного белка с помощью скрытой марковской модели: приложение для полных геномов. Журнал молекулярной биологии. 2001, 19 января; 305 (3): 567–80. pmid: 11152613
  32. 32. Келли Л.А., Мезулис С., Йейтс С.М., Васс М.Н., Штернберг М.Дж. Веб-портал Phyre2 для моделирования, прогнозирования и анализа белков. Протоколы природы. 2015 июн; 10 (6): 845–58. pmid: 25950237
  33. 33.Sigrist CJ, Cerutti L, Hulo N, Gattiker A, Falquet L, Pagni M и др. PROSITE: документированная база данных, использующая шаблоны и профили в качестве дескрипторов мотивов. Брифинги по биоинформатике. 2002, сентябрь 1; 3 (3): 265–74. pmid: 12230035
  34. 34. Мишра Н.К., Чанг Дж., Чжао П.Х. Прогнозирование белков мембранного транспорта и их субстратной специфичности с использованием информации о первичной последовательности. ПлоС один. 2014 26 июня; 9 (6): e100278. pmid: 24968309
  35. 35. Олиас П., Адам I, Мейер А., Шарфф С., Грубер А.Д.Контрольные гены для количественных исследований экспрессии генов у нескольких видов птиц. ПлоС один. 2014, 13 июня; 9 (6): e99678. pmid: 24926893
  36. 36. Шарма А.К., Шайни М., Сингх С.Д., Пракаш В., Дас А., Дасан РБ и др. Диклофенак токсичен для степного орла Aquila nipalensis: увеличивает разнообразие хищных птиц, которым угрожает злоупотребление НПВП в Южной Азии. Международная организация по охране птиц. 2014 Сен; 24 (3): 282–6.
  37. 37. Sweet DH, Wolff NA, Pritchard JB. Клонирование экспрессии и характеристика ROAT1 — переносчика базолатеральных органических анионов в почках крысы.Журнал биологической химии. 1997, 28 ноября; 272 (48): 30088–95. pmid: 9374486
  38. 38. Лу Р, Чан Б.С., Шустер В.Л. Клонирование переносчика ПАУ в почках человека: узкая субстратная специфичность и регуляция протеинкиназой С. Американский журнал физиологии-почечной физиологии. 1999, 1 февраля; 276 (2): F295–303. pmid: 9950961
  39. 39. Race JE, Grassl SM, Williams WJ, Holtzman EJ. Молекулярное клонирование и характеристика двух новых переносчиков органических анионов почек человека (hOAT1 и hOAT3).Сообщения о биохимических и биофизических исследованиях. 1999 16 февраля; 255 (2): 508–14. pmid: 10049739
  40. 40. Танака К., Сюй В., Чжоу Ф., Ю Г. Роль гликозилирования в транспортере органических анионов OAT1. Журнал биологической химии. 2004, 9 апреля; 279 (15): 14961–6. pmid: 14749323
  41. 41. Чжоу Ф., Сюй В., Хун М., Пан З., Синко П.Дж., Ма Дж. И др. Роль N-связанного гликозилирования в сворачивании белка, нацеливании на мембрану и связывании субстрата человеческого органического переносчика анионов hOAT4.Молекулярная фармакология. 1 марта 2005 г.; 67 (3): 868–76. pmid: 15576633
  42. 42. Green RE, Newton IA, Shultz S, Cunningham AA, Gilbert M, Pain DJ и др. Отравление диклофенаком как причина сокращения популяции стервятников на Индийском субконтиненте. Журнал прикладной экологии. 2004 Октябрь; 41 (5): 793–800. pmid: 15801603
  43. 43. Swan GE, Cuthbert R, Quevedo M, Green RE, Pain DJ, Bartels P и др. Токсичность диклофенака для грифов. Письма биологии. 2006 22 июня; 2 (2): 279–82.pmid: 17148382
  44. 44. Найду В., Дункан Н., Беккер Л., Свон Г. Проверка домашней птицы в качестве модели для исследования патофизиологии диклофенака у грифов Gyps. Экологическая токсикология и фармакология. 2007, 1 ноября; 24 (3): 260–6. pmid: 21783820
  45. 45. Хуссейн I, Хан М.З., Хан А., Джавед I, Салими МК. Токсикологические эффекты диклофенака у четырех видов птиц. Патология птиц. 1 июня 2008 г.; 37 (3): 315–21. pmid: 18568659
.